MOTIF A 1-1 554 ccggaatata TCTTTT cgggaagctc 559 1.000000 2-1 249 GTATTtatcg TCTTTT cgcTGTAAAa 254 1.000000 3-1 241 Tgcggtagaa TCTTTT cacaaaaggt 246 1.000000 4-1 699 cataactttt TTTTTT gaacctgaat 704 1.000000 5-1 251 ctctgttaaa TTTTTT tttttttaaa 256 1.000000 6-1 172 ttttatgcta TTTTTT aaatttggag 177 1.000000 7-1 179 atattaacaa TTTTTT gttgatactt 184 1.000000 8-1 160 aaattcttac TTTTTT tttggatgga 165 1.000000 9-1 502 aagtgccttt TTTTTT ttttttcatc 507 1.000000 10-1 7 tctcat TTTTTT ctactcataa 12 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 554 559 556 -w 1.000000 >2 249 254 251 -w 1.000000 >3 241 246 243 -w 1.000000 >4 699 704 701 -w 1.000000 >5 251 256 253 -w 1.000000 >6 172 177 174 -w 1.000000 >7 179 184 181 -w 1.000000 >8 160 165 162 -w 1.000000 >9 502 507 504 -w 1.000000 >10 7 12 9 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . 29 . 66 0.7 3 . . . 94 1.3 4 . . . 94 1.3 5 . . . 94 1.3 6 . . . 94 1.3 non- site . . . 31 site . . . 95 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . 2 . 7 7 3 . . . 15 13 4 . . . 15 13 5 . . . 15 13 6 . . . 15 13 site . . . 15 14 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.290852 0.016568 0.664773 0.728885 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.077325 Conservedness in prob: 9.013818 Concensus sequence: TTTTTT Complete log-likelihood ratio = 94 bits Missing position information = 63 bits Log-likelihood ratio statistic = 31 bits Degrees of freedom = 18 Information per parameter = 1.74 bits MOTIF B 1-1 647 ttttgtagga AATCACTT agaacttgcc 654 1.000000 2-1 297 tacacttatt AACCGCTT ttactattat 304 1.000000 3-1 499 gagattagtt AAGCCCTT cccatctcaa 506 1.000000 4-1 308 ctccagatgg AATCCCTT ccatagagag 315 1.000000 5-1 668 ggcAGTAAAg AATTGCTT tactgggcgt 675 1.000000 6-1 376 aactattgcg AAGCGCTT cagtgaaaaa 383 1.000000 7-1 746 atgattatta AACTTCTT tgcgtccatc 753 1.000000 8-1 676 AAagctgcat AACCACTT taactaatac 683 1.000000 9-1 480 tctgccattc TACCCCTT attcaagtgc 487 1.000000 10-1 87 tacatgcttc AACTACTT aataaatgat 94 1.000000 sites: ** * *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 647 654 650 -w 1.000000 >2 297 304 300 -w 1.000000 >3 499 506 502 -w 1.000000 >4 308 315 311 -w 1.000000 >5 668 675 671 -w 1.000000 >6 376 383 379 -w 1.000000 >7 746 753 749 -w 1.000000 >8 676 683 679 -w 1.000000 >9 480 487 483 -w 1.000000 >10 87 94 90 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 2 94 . . . 1.3 4 . 65 . . 1.0 6 . 93 . . 1.8 7 . . . 94 1.3 8 . . . 94 1.3 non- site . 19 . 31 site . 28 . 40 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 2 15 . . . 13 4 . 11 . . 10 6 . 21 . . 18 7 . . . 15 13 8 . . . 15 13 site . 1 . 1 3 Weighted motif model: POS A C G T Prob 1 0.845989 0.018125 0.016568 0.119318 0.955898 2 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.027807 0.654489 0.016568 0.301136 0.952767 6 0.027807 0.927216 0.016568 0.028409 1.804236 7 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.547021 Conservedness in prob: 10.184875 Concensus sequence: AACCTT Complete log-likelihood ratio = 98 bits Missing position information = 74 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.38 bits MOTIF C 1-1 596 atccgattct TACTCC atatcatgcc 601 1.000000 2-1 211 GTACATACCT CTCTCC gtatcctcgt 216 1.000000 3-1 478 cggggcggat CACTCC gaaccgagat 483 1.000000 4-1 424 ctaatccggt CACTGC cactgctgct 429 1.000000 5-1 52 TAAAATTTtt CACTCT ttctgcgcgc 57 1.000000 6-1 108 tgaaaatatg CACTCT atatctttta 113 1.000000 7-1 106 caggtacaat CACTTC ttctgaatga 111 1.000000 8-1 392 cgacggaaga CTCTCC tccgtgcgtc 397 1.000000 9-1 693 ttgttcattt CACTCC aagtattttt 698 1.000000 10-1 724 ttcttaattt CACTCT aaagcatacc 729 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 596 601 598 -w 1.000000 >2 211 216 213 -w 1.000000 >3 478 483 480 -w 1.000000 >4 424 429 426 -w 1.000000 >5 52 57 54 -w 1.000000 >6 108 113 110 -w 1.000000 >7 106 111 108 -w 1.000000 >8 392 397 394 -w 1.000000 >9 693 698 695 -w 1.000000 >10 724 729 726 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.4 2 76 . . . 0.7 3 . 93 . . 1.8 4 . . . 94 1.3 5 . 75 . . 1.1 6 . 65 . . 1.0 non- site . 19 . . site . 56 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 14 2 10 . . . 7 3 . 21 . . 18 4 . . . 15 13 5 . 14 . . 11 6 . 11 . . 10 site . 9 . . 6 Weighted motif model: POS A C G T Prob 1 0.027807 0.836307 0.016568 0.119318 1.410690 2 0.755080 0.018125 0.016568 0.210227 0.744138 3 0.027807 0.927216 0.016568 0.028409 1.804236 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.745398 0.107477 0.119318 1.074319 6 0.027807 0.654489 0.016568 0.301136 0.952767 Conservedness in bits: 7.255839 Conservedness in prob: 10.792027 Concensus sequence: CACTCC Complete log-likelihood ratio = 94 bits Missing position information = 68 bits Log-likelihood ratio statistic = 25 bits Degrees of freedom = 18 Information per parameter = 1.41 bits MOTIF D 1-1 298 taacgttgaa ATGGAAG aagacgtttt 304 1.000000 2-1 81 tttcaccgca ATGGAAT caaacttgtt 87 1.000000 3-1 225 tcaaactcca ATTAAAT gcggtagaaT 231 1.000000 4-1 124 ctgccatggc AAAGAAT gctttccatg 130 1.000000 5-1 389 caaacttcct ATGGAGT gtataagaat 395 1.000000 6-1 586 cccaaaaata AGGGAAA gggtccaaaa 592 1.000000 7-1 531 acgaggacgc ACGGAGG agagtcttCC 537 1.000000 8-1 661 agatatataa ATGGAAA agctgcatAA 667 1.000000 9-1 462 taccgtagac ATGGAAT atctgccatt 468 1.000000 10-1 793 taagaatagg AGGGAAT a 799 1.000000 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 298 304 301 -w 1.000000 >2 81 87 84 -w 1.000000 >3 225 231 228 -w 1.000000 >4 124 130 127 -w 1.000000 >5 389 395 392 -w 1.000000 >6 586 592 589 -w 1.000000 >7 531 537 534 -w 1.000000 >8 661 667 664 -w 1.000000 >9 462 468 465 -w 1.000000 >10 793 799 796 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 3 . . 74 . 1.1 4 . . 83 . 1.5 5 94 . . . 1.3 6 76 . . . 0.8 7 . . . 57 0.4 non- site 30 . 18 . site 53 . 35 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 3 . . 15 . 11 4 . . 18 . 15 5 15 . . . 13 6 10 . . . 8 7 . . . 5 4 site 4 . 3 . 6 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 3 0.118716 0.018125 0.743841 0.119318 1.118771 4 0.118716 0.018125 0.834750 0.028409 1.509552 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.755080 0.018125 0.198386 0.028409 0.847687 7 0.209625 0.018125 0.198386 0.573864 0.350499 Conservedness in bits: 6.415997 Conservedness in prob: 9.634938 Concensus sequence: AGGAAT Complete log-likelihood ratio = 83 bits Missing position information = 56 bits Log-likelihood ratio statistic = 26 bits Degrees of freedom = 18 Information per parameter = 1.48 bits MOTIF E 1-1 502 gactctaagt AGTAAA agtattatgc 507 1.000000 2-1 258 gTCTTTTcgc TGTAAA aactttatca 263 1.000000 3-1 757 gtaatagtta AGTAAA cacaagatta 762 1.000000 4-1 99 gccgttgtct TGCAAA cggccgcctc 104 1.000000 5-1 661 agactacggc AGTAAA gAATTGCTTt 666 1.000000 6-1 670 atagccaagc TGAAAA taatgtgtag 675 1.000000 7-1 292 Tgttaataga TCAAAA atcatcgctt 297 1.000000 8-1 259 gttgtggaaa TGTAAA gagccccatt 264 1.000000 9-1 154 ttttctctat TGTAAA gcggaaaaaa 159 1.000000 10-1 322 gacgagatgc AGTAAA aagagattgc 327 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 502 507 504 -w 1.000000 >2 258 263 260 -w 1.000000 >3 757 762 759 -w 1.000000 >4 99 104 101 -w 1.000000 >5 661 666 663 -w 1.000000 >6 670 675 672 -w 1.000000 >7 292 297 294 -w 1.000000 >8 259 264 261 -w 1.000000 >9 154 159 156 -w 1.000000 >10 322 327 324 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 39 . . 57 0.5 2 . . 83 . 1.5 3 . . . 66 0.5 4 94 . . . 1.3 5 94 . . . 1.3 6 94 . . . 1.3 non- site 30 . . . site 60 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 1 . . 5 5 2 . . 18 . 15 3 . . . 7 5 4 15 . . . 13 5 15 . . . 13 6 15 . . . 13 site 6 . . . 3 Weighted motif model: POS A C G T Prob 1 0.391443 0.018125 0.016568 0.573864 0.522474 2 0.027807 0.109034 0.834750 0.028409 1.543220 3 0.209625 0.109034 0.016568 0.664773 0.457415 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.407341 Conservedness in prob: 9.006130 Concensus sequence: TGTAAA Complete log-likelihood ratio = 84 bits Missing position information = 58 bits Log-likelihood ratio statistic = 25 bits Degrees of freedom = 18 Information per parameter = 1.41 bits MOTIF F 1-1 741 atacctgcta TTATATAATCTT cgactcgcat 752 1.000000 2-1 232 ctcgtaatca TTTTCTTGTATT tatcgTCTTT 243 1.000000 3-1 724 attatgcacc TTATTCAATTAT catcaagaat 735 1.000000 4-1 233 cctgctggtc TTCTGGTCTGTT agggcaaggt 244 1.000000 5-1 218 agttctacat TTTTTTTTTTTT ggaagtatga 229 1.000000 6-1 558 TAGATatatt TTCTGTCATTTT ccttaaccca 569 1.000000 7-1 132 gatttagtca TTATAGTTTTTT ctccttgacg 143 1.000000 8-1 492 caatactagc TTTTATGGTTAT gaagaggaaa 503 1.000000 9-1 579 caaatgacat TTTTCCTTTCTT ctcaaacttt 590 1.000000 10-1 352 ttgaaacttt TTGTCCTTTTTT ttttccgggg 363 1.000000 sites: ** * * ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 741 752 746 -w 1.000000 >2 232 243 237 -w 1.000000 >3 724 735 729 -w 1.000000 >4 233 244 238 -w 1.000000 >5 218 229 223 -w 1.000000 >6 558 569 563 -w 1.000000 >7 132 143 137 -w 1.000000 >8 492 503 497 -w 1.000000 >9 579 590 584 -w 1.000000 >10 352 363 357 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 4 . . . 94 1.3 9 . . . 94 1.3 11 . . . 76 0.7 12 . . . 94 1.3 non- site . . . 31 site . . . 96 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 4 . . . 15 13 9 . . . 15 13 11 . . . 10 7 12 . . . 15 13 site . . . 16 15 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.016568 0.937500 1.269688 9 0.027807 0.018125 0.016568 0.937500 1.269688 11 0.209625 0.018125 0.016568 0.755682 0.728388 12 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.076828 Conservedness in prob: 9.198735 Concensus sequence: TTTTTT Complete log-likelihood ratio = 94 bits Missing position information = 60 bits Log-likelihood ratio statistic = 34 bits Degrees of freedom = 18 Information per parameter = 1.89 bits MOTIF G 1-1 257 ttccaattga AGAAGGTCTTGTGTTT ggctgttgcc 272 1.000000 2-1 748 tattagcgga ATCAGGAGTGCAAAAA gagaaaataa 763 1.000000 3-1 2 c ATTAATTTTGCTTCCA agacgacagt 17 1.000000 4-1 391 aaagtgcaag CATAGTGGGGCCTTCT tccaatgcta 406 1.000000 5-1 510 atttcgcctt CTCAGAAAGGGGTAGA atcaatctag 525 1.000000 6-1 537 cactgttgag CGAAGGCTCATTAGAT atattTTCTG 552 1.000000 7-1 633 gaaagttcca AAGAGAAGGTTTTTTT aggctaagat 648 1.000000 8-1 619 ggggtaatta ATCAGCGAAGCGATGA tttttgatct 634 1.000000 9-1 211 cactaaaacg ATCAGCAAATGGCAGA ataacgcggt 226 1.000000 10-1 581 TTagacaagg ACAAAATCAGGACAAA ttgtaaagat 596 1.000000 sites: * ** ** * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 257 272 264 -w 1.000000 >2 748 763 755 -w 1.000000 >3 2 17 9 -w 1.000000 >4 391 406 398 -w 1.000000 >5 510 525 517 -w 1.000000 >6 537 552 544 -w 1.000000 >7 633 648 640 -w 1.000000 >8 619 634 626 -w 1.000000 >9 211 226 218 -w 1.000000 >10 581 596 588 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 66 29 . . 0.7 4 94 . . . 1.3 5 . . 74 . 1.2 10 . . 56 . 0.7 11 . 38 38 . 0.5 16 57 . . 39 0.5 non- site 30 . 18 . site 43 . 30 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 7 2 . . 7 4 15 . . . 13 5 . . 15 . 12 10 . . 9 . 7 11 . 4 4 . 5 16 5 . . 1 5 site 2 . 2 . 2 Weighted motif model: POS A C G T Prob 1 0.664170 0.290852 0.016568 0.028409 0.745810 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.209625 0.018125 0.743841 0.028409 1.234055 10 0.118716 0.018125 0.562023 0.301136 0.672231 11 0.027807 0.381761 0.380205 0.210227 0.544698 16 0.573261 0.018125 0.016568 0.392045 0.527763 Conservedness in bits: 5.019301 Conservedness in prob: 8.354453 Concensus sequence: AAGGGA Complete log-likelihood ratio = 66 bits Missing position information = 48 bits Log-likelihood ratio statistic = 17 bits Degrees of freedom = 18 Information per parameter = 0.975 bits MOTIF H 1-1 439 ctaatcactt CCGAGCGA ttaatacata 446 1.000000 2-1 623 aattgattga CCGCCTGC aacacatagg 630 1.000000 3-1 620 aacaaacatt TCGCAGGC taaaatgtgg 627 1.000000 4-1 628 tcttcattta CCGGCGCA ctctcgcccg 635 1.000000 5-1 292 tcccagaaat CCGCTTGA atgtcttaca 299 1.000000 6-1 630 tgaccgtgat CCGAAGGA ctggctatac 637 1.000000 7-1 546 GGagagtctt CCGTCGGA gggctgtcgc 553 1.000000 8-1 418 ctcgtcttca CCGGTCGC gttcctgaaa 425 1.000000 9-1 346 gaaatggagt CCGTGCGA gttttgttag 353 1.000000 10-1 478 cagaaaaatt CCGATGGA caagaagata 485 1.000000 sites: *** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 439 446 442 -w 1.000000 >2 623 630 626 -w 1.000000 >3 620 627 623 -w 1.000000 >4 628 635 631 -w 1.000000 >5 292 299 295 -w 1.000000 >6 630 637 633 -w 1.000000 >7 546 553 549 -w 1.000000 >8 418 425 421 -w 1.000000 >9 346 353 349 -w 1.000000 >10 478 485 481 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.4 2 . 93 . . 1.8 3 . . 93 . 1.9 6 . 29 47 . 0.6 7 . . 83 . 1.5 8 66 29 . . 0.7 non- site . 19 18 . site . 43 40 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 14 2 . 21 . . 18 3 . . 22 . 19 6 . 2 6 . 6 7 . . 18 . 15 8 7 2 . . 7 site . 5 5 . 6 Weighted motif model: POS A C G T Prob 1 0.027807 0.836307 0.016568 0.119318 1.410690 2 0.027807 0.927216 0.016568 0.028409 1.804236 3 0.027807 0.018125 0.925659 0.028409 1.913088 6 0.027807 0.290852 0.471114 0.210227 0.587530 7 0.027807 0.109034 0.834750 0.028409 1.543220 8 0.664170 0.290852 0.016568 0.028409 0.745810 Conservedness in bits: 8.004574 Conservedness in prob: 11.314724 Concensus sequence: CCGGGA Complete log-likelihood ratio = 103 bits Missing position information = 78 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.37 bits MOTIF I 1-1 672 gccttacttt AAAAGCA tgttgagtga 678 1.000000 2-1 403 agtcgtcaag TAAAGAT ttcgtgttca 409 1.000000 3-1 686 taattggatt GAAAATT tggtgttgtg 692 1.000000 4-1 653 ccgaacgacc TCAAAAT gtctgctaca 659 1.000000 5-1 90 gcaactactc AATAGGT aacatgagaa 96 1.000000 6-1 291 aaaatctatg GAAAGAT atggacggta 297 1.000000 7-1 207 atgacatttg AATAAGA agtaatacaa 213 1.000000 8-1 789 acgtcaagga GAAAAAA ctata 795 1.000000 9-1 676 gaaacataca AAAAGAT ttgttcattt 682 1.000000 10-1 566 tgaaaaattt TCAAGTT agacaaggAC 572 1.000000 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 672 678 675 -w 1.000000 >2 403 409 406 -w 1.000000 >3 686 692 689 -w 1.000000 >4 653 659 656 -w 1.000000 >5 90 96 93 -w 1.000000 >6 291 297 294 -w 1.000000 >7 207 213 210 -w 1.000000 >8 789 795 792 -w 1.000000 >9 676 682 679 -w 1.000000 >10 566 572 569 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 39 . 29 . 0.3 2 76 . . . 0.8 3 76 . . . 0.7 4 94 . . . 1.3 5 39 . 56 . 0.9 7 . . . 66 0.6 non- site 30 . . . site 61 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 1 . 2 . 3 2 10 . . . 8 3 10 . . . 7 4 15 . . . 13 5 1 . 9 . 9 7 . . . 7 6 site 6 . . . 4 Weighted motif model: POS A C G T Prob 1 0.391443 0.018125 0.289295 0.301136 0.253356 2 0.755080 0.199943 0.016568 0.028409 0.829612 3 0.755080 0.018125 0.016568 0.210227 0.744138 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.391443 0.018125 0.562023 0.028409 0.891441 7 0.300534 0.018125 0.016568 0.664773 0.596285 Conservedness in bits: 4.609576 Conservedness in prob: 7.602662 Concensus sequence: GAAAGT Complete log-likelihood ratio = 61 bits Missing position information = 50 bits Log-likelihood ratio statistic = 11 bits Degrees of freedom = 18 Information per parameter = 0.62 bits MOTIF J 1-1 138 tcaagcaagt TCCAAGACTATTGGG tcctcaattg 152 1.000000 2-1 196 tatataaata CACATGTACATACCT CTCTCCgtat 210 1.000000 3-1 398 cggtctttcg TCCGTGCGGAGATAT ctgcgccgtt 412 1.000000 4-1 573 ttctctcccc TGCAATATAATAGTT taattctaat 587 1.000000 5-1 35 atttctatat TCCACTATAAAATTT ttCACTCTtt 49 1.000000 6-1 188 aaatttggag TTCAGTGATAAAAGT gtcacagcga 202 1.000000 7-1 268 atgcagcttt TCCATTTATATATCT gttaatagaT 282 1.000000 8-1 28 cacagtcata TCCATTCTCAATTAG ctctaccaca 42 1.000000 9-1 11 tagctctatg TACATTGCCAAGGTT ttctactgat 25 1.000000 10-1 119 tgataatgtt TTCAATGTAAGAGAT ttcgattatc 133 1.000000 sites: * ** * * * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 138 152 145 -w 1.000000 >2 196 210 203 -w 1.000000 >3 398 412 405 -w 1.000000 >4 573 587 580 -w 1.000000 >5 35 49 42 -w 1.000000 >6 188 202 195 -w 1.000000 >7 268 282 275 -w 1.000000 >8 28 42 35 -w 1.000000 >9 11 25 18 -w 1.000000 >10 119 133 126 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 1.0 3 . 93 . . 1.8 4 85 . . . 1.0 6 . . 29 66 0.8 10 94 . . . 1.3 15 . . . 76 0.8 non- site . . . 31 site . . . 40 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 10 3 . 21 . . 18 4 12 . . . 10 6 . . 2 7 8 10 15 . . . 13 15 . . . 10 8 site . . . 1 0 Weighted motif model: POS A C G T Prob 1 0.027807 0.109034 0.016568 0.846591 0.968787 3 0.027807 0.927216 0.016568 0.028409 1.804236 4 0.845989 0.018125 0.107477 0.028409 0.998787 6 0.027807 0.018125 0.289295 0.664773 0.757894 10 0.936898 0.018125 0.016568 0.028409 1.294744 15 0.027807 0.018125 0.198386 0.755682 0.828064 Conservedness in bits: 6.652513 Conservedness in prob: 9.100803 Concensus sequence: TCATAT Complete log-likelihood ratio = 87 bits Missing position information = 68 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.07 bits seed 1 time: 7 seconds (0.12 minutes) MOTIF A 1-1 359 gTTTCTTTgt TGAAGA agaacTGGCA 364 1.000000 2-1 36 tgattgtaca GGAAAA tATACATCGC 41 1.000000 3-1 643 tgtggagata GGATAA gtttTGTAGA 648 1.000000 4-1 442 ctgctgctac GGAAAA ccaacctaaa 447 1.000000 5-1 646 cgagctttca GGAAAA gactacggca 651 1.000000 6-1 401 aaaatcataa GGAAAA gttgtaaata 406 1.000000 7-1 785 taagaatttt TGAAAA ttcaatataa 790 1.000000 8-1 663 atatataaat GGAAAA gctgcataac 668 1.000000 9-1 47 aatatttgat GGAAAA atatgacata 52 1.000000 10-1 455 agcgcgagga GGAAAA gaaatgacag 460 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 359 364 361 -w 1.000000 >2 36 41 38 -w 1.000000 >3 643 648 645 -w 1.000000 >4 442 447 444 -w 1.000000 >5 646 651 648 -w 1.000000 >6 401 406 403 -w 1.000000 >7 785 790 787 -w 1.000000 >8 663 668 665 -w 1.000000 >9 47 52 49 -w 1.000000 >10 455 460 457 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 74 . 1.2 2 . . 93 . 1.9 3 94 . . . 1.3 4 85 . . . 1.0 5 85 . . . 1.0 6 94 . . . 1.3 non- site 30 . 18 . site 63 . 31 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 15 . 12 2 . . 22 . 19 3 15 . . . 13 4 12 . . . 10 5 12 . . . 10 6 15 . . . 13 site 7 . 3 . 8 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.743841 0.210227 1.230181 2 0.027807 0.018125 0.925659 0.028409 1.913088 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.845989 0.018125 0.016568 0.119318 0.955898 5 0.845989 0.018125 0.107477 0.028409 0.998787 6 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 7.687442 Conservedness in prob: 10.538928 Concensus sequence: GGAAAA Complete log-likelihood ratio = 100 bits Missing position information = 71 bits Log-likelihood ratio statistic = 29 bits Degrees of freedom = 18 Information per parameter = 1.61 bits MOTIF B 1-1 2 g ACAGAGCTAAG tcttgcggtg 12 1.000000 2-1 402 aagtcgtcaa GTAAAGATTTC gtgttcatgc 412 1.000000 3-1 611 tgttcaaaaa ACAAACATTTC gcaggctaaa 621 1.000000 4-1 478 tcttcactat AAGAAAATCAC acgagcgccc 488 1.000000 5-1 563 cggcttaata ATATGCCTATC aggcattcac 573 1.000000 6-1 509 tctccttttg GAAAGCTATAC ttcggagcac 519 1.000000 7-1 338 aataaggcta AAAAACTAATC gcattatcat 348 1.000000 8-1 735 ttcaaatgtc ATAAAAGTATC aacaaaaaat 745 1.000000 9-1 432 gaaaatacga GTCCATTTCTC cagtgaaact 442 1.000000 10-1 557 acatcagaat GAAAAATTTTC aagttagaca 567 1.000000 sites: * ** * ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 2 12 7 -w 1.000000 >2 402 412 407 -w 1.000000 >3 611 621 616 -w 1.000000 >4 478 488 483 -w 1.000000 >5 563 573 568 -w 1.000000 >6 509 519 514 -w 1.000000 >7 338 348 343 -w 1.000000 >8 735 745 740 -w 1.000000 >9 432 442 437 -w 1.000000 >10 557 567 562 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 57 . 38 . 0.8 5 76 . . . 0.8 6 . 38 . . 0.2 8 . . . 76 0.7 10 . . . 66 0.6 11 . 84 . . 1.5 non- site 30 . . . site 36 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 5 . 4 . 8 5 10 . . . 8 6 . 4 . . 2 8 . . . 10 7 10 . . . 7 6 11 . 17 . . 15 site 1 . . . 0 Weighted motif model: POS A C G T Prob 1 0.573261 0.018125 0.380205 0.028409 0.761880 5 0.755080 0.018125 0.198386 0.028409 0.847687 6 0.300534 0.381761 0.198386 0.119318 0.208687 8 0.209625 0.018125 0.016568 0.755682 0.728388 10 0.300534 0.018125 0.016568 0.664773 0.596285 11 0.027807 0.836307 0.107477 0.028409 1.453580 Conservedness in bits: 4.596507 Conservedness in prob: 7.733206 Concensus sequence: GACTTC Complete log-likelihood ratio = 60 bits Missing position information = 47 bits Log-likelihood ratio statistic = 12 bits Degrees of freedom = 18 Information per parameter = 0.715 bits MOTIF C 1-1 350 aacttctttg TTTCTTT gtTGAAGAag 356 1.000000 2-1 365 aacacagtgg TTTCTTT gcataaacac 371 1.000000 3-1 310 taggttgcaa TTTCTTT ttctattagt 316 1.000000 4-1 697 ctcataactt TTTTTTT tgaacctgaa 703 1.000000 5-1 218 agttctacat TTTTTTT tttttggaag 224 1.000000 6-1 464 atttttcccc TTTATTT tgttcataca 470 1.000000 7-1 272 agcttttcca TTTATAT atctgttaat 278 1.000000 8-1 160 AAATTCTtac TTTTTTT ttggatggac 166 1.000000 9-1 623 taactgcttc TTTTTTT attAAAAAAC 629 1.000000 10-1 358 ctttttgtcc TTTTTTT tttccgggga 364 1.000000 sites: *** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 350 356 353 -w 1.000000 >2 365 371 368 -w 1.000000 >3 310 316 313 -w 1.000000 >4 697 703 700 -w 1.000000 >5 218 224 221 -w 1.000000 >6 464 470 467 -w 1.000000 >7 272 278 275 -w 1.000000 >8 160 166 163 -w 1.000000 >9 623 629 626 -w 1.000000 >10 358 364 361 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 3 . . . 94 1.3 5 . . . 94 1.3 6 . . . 85 0.9 7 . . . 94 1.3 non- site . . . 31 site . . . 98 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 3 . . . 15 13 5 . . . 15 13 6 . . . 12 9 7 . . . 15 13 site . . . 16 16 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.118716 0.018125 0.016568 0.846591 0.935119 7 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.283558 Conservedness in prob: 9.362621 Concensus sequence: TTTTTT Complete log-likelihood ratio = 96 bits Missing position information = 64 bits Log-likelihood ratio statistic = 31 bits Degrees of freedom = 18 Information per parameter = 1.78 bits MOTIF D 1-1 493 aatacgtatg ACTCTAAGTAGTAAAAGTA ttatgcatag 511 1.000000 2-1 43 acaGGAAAAt ATACATCGCAGGGGGTTGA cttttaccat 61 1.000000 3-1 772 acacaagatt AACATAATAAAAAAAATAA ttctttcata 790 1.000000 4-1 129 atggcaaaga ATGCTTTCCATGACGATCA tcgtagtgcc 147 1.000000 5-1 271 tttaaatttc ACTTTCTAAAGTCCCAGAA atccgcttga 289 1.000000 6-1 55 cgggtccaag ATTGTCTACAGATTTTCCT gatTTGCCAg 73 1.000000 7-1 7 cggttt AGCATCATAAGCGCTTATA aatttcttaa 25 1.000000 8-1 183 ggacgcaaag AAGTTTAATAATCATATTA catggcatta 201 1.000000 9-1 271 aaacccagtc ATACTATGAAGTCCCTAAA attattccga 289 1.000000 10-1 45 aaaatacgca ATAATAACGAGTAGTAACA cttttatagt 63 1.000000 sites: * * ** * * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 493 511 502 -w 1.000000 >2 43 61 52 -w 1.000000 >3 772 790 781 -w 1.000000 >4 129 147 138 -w 1.000000 >5 271 289 280 -w 1.000000 >6 55 73 64 -w 1.000000 >7 7 25 16 -w 1.000000 >8 183 201 192 -w 1.000000 >9 271 289 280 -w 1.000000 >10 45 63 54 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 5 . . . 85 0.9 10 94 . . . 1.3 11 . . 65 . 0.9 16 57 . . 39 0.5 19 85 . . . 1.0 non- site 30 . . . site 63 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 5 . . . 12 9 10 15 . . . 13 11 . . 12 . 9 16 5 . . 1 5 19 12 . . . 10 site 7 . . . 5 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.118716 0.018125 0.016568 0.846591 0.935119 10 0.936898 0.018125 0.016568 0.028409 1.294744 11 0.209625 0.018125 0.652932 0.119318 0.859343 16 0.573261 0.018125 0.016568 0.392045 0.527763 19 0.845989 0.018125 0.016568 0.119318 0.955898 Conservedness in bits: 5.867612 Conservedness in prob: 8.882668 Concensus sequence: ATAGAA Complete log-likelihood ratio = 76 bits Missing position information = 59 bits Log-likelihood ratio statistic = 17 bits Degrees of freedom = 18 Information per parameter = 0.969 bits MOTIF E 1-1 370 GAAGAagaac TGGCAAAAT gttggttcct 378 1.000000 2-1 97 tcaaacttgt TGAAGAGAA tgttcacagg 105 1.000000 3-1 653 GGATAAgttt TGTAGACAT atataaacaa 661 1.000000 4-1 367 ccactggacc TGAAGACAT gcaacaaagt 375 1.000000 5-1 101 atAGGTAAca TGAGAATAT TTCAGTTCGt 109 1.000000 6-1 263 tgtaccacca TGGAGACAT caaaaattga 271 1.000000 7-1 226 taatacaaac TGAAAATGT tgaaagtatT 234 1.000000 8-1 253 ttatatgttg TGGAAATGT aaagagcccc 261 1.000000 9-1 402 tataattttg TGGAAAAAT tcatcgtgag 410 1.000000 10-1 598 caggacaaat TGTAAAGAT ataataaact 606 1.000000 sites: ** ** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 370 378 374 -w 1.000000 >2 97 105 101 -w 1.000000 >3 653 661 657 -w 1.000000 >4 367 375 371 -w 1.000000 >5 101 109 105 -w 1.000000 >6 263 271 267 -w 1.000000 >7 226 234 230 -w 1.000000 >8 253 261 257 -w 1.000000 >9 402 410 406 -w 1.000000 >10 598 606 602 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . 93 . 1.9 5 57 . 38 . 0.8 6 94 . . . 1.3 8 76 . . . 0.8 9 . . . 85 0.9 non- site 30 . 18 . site 41 . 26 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . 22 . 19 5 5 . 4 . 8 6 15 . . . 13 8 10 . . . 8 9 . . . 12 9 site 2 . 1 . 3 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.925659 0.028409 1.913088 5 0.573261 0.018125 0.380205 0.028409 0.761880 6 0.936898 0.018125 0.016568 0.028409 1.294744 8 0.755080 0.018125 0.198386 0.028409 0.847687 9 0.118716 0.018125 0.016568 0.846591 0.935119 Conservedness in bits: 7.022206 Conservedness in prob: 9.346826 Concensus sequence: TGGAAT Complete log-likelihood ratio = 92 bits Missing position information = 69 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.27 bits MOTIF F 1-1 432 gattgtacta ATCACTTCCGAGC gattaataca 444 1.000000 2-1 580 agaatgaaat CGCCATGCCAAGC catcacacgg 592 1.000000 3-1 392 caccggcggt CTTTCGTCCGTGC ggagatatct 404 1.000000 4-1 563 tacccctttc TTCTCTCCCCTGC aatataatag 575 1.000000 5-1 69 tctgcgcgcg CCAATGTCCCCGC aactactcaa 81 1.000000 6-1 210 agtgtcacag CGAATTTCCTCAC atgtagggac 222 1.000000 7-1 140 cattatagtt TTTTCTCCTTGAC gttaaAGTAT 152 1.000000 8-1 439 cctgaaacgc AGATGTGCCTCGC gccgcactgc 451 1.000000 9-1 339 gtccggggaa ATGGAGTCCGTGC gagttttgtt 351 1.000000 10-1 287 aagtcatttg CGAAGTTCTTGGC aagttgccaa 299 1.000000 sites: * * ** ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 432 444 438 -w 1.000000 >2 580 592 586 -w 1.000000 >3 392 404 398 -w 1.000000 >4 563 575 569 -w 1.000000 >5 69 81 75 -w 1.000000 >6 210 222 216 -w 1.000000 >7 140 152 146 -w 1.000000 >8 439 451 445 -w 1.000000 >9 339 351 345 -w 1.000000 >10 287 299 293 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 47 . . 0.4 6 . . 29 66 0.8 8 . 93 . . 1.8 9 . 75 . . 1.1 12 . . 74 . 1.2 13 . 93 . . 1.8 non- site . 19 . . site . 55 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 6 . . 4 6 . . 2 7 8 8 . 21 . . 18 9 . 14 . . 11 12 . . 15 . 12 13 . 21 . . 18 site . 8 . . 5 Weighted motif model: POS A C G T Prob 1 0.300534 0.472670 0.016568 0.210227 0.403456 6 0.027807 0.018125 0.289295 0.664773 0.757894 8 0.027807 0.927216 0.016568 0.028409 1.804236 9 0.027807 0.745398 0.016568 0.210227 1.144396 12 0.209625 0.018125 0.743841 0.028409 1.234055 13 0.027807 0.927216 0.016568 0.028409 1.804236 Conservedness in bits: 7.148273 Conservedness in prob: 10.700798 Concensus sequence: CTCCGC Complete log-likelihood ratio = 92 bits Missing position information = 63 bits Log-likelihood ratio statistic = 29 bits Degrees of freedom = 18 Information per parameter = 1.62 bits MOTIF G 1-1 249 ccatcaagtt CCAATTGAAGA aggtcttgtg 259 1.000000 2-1 751 tagcggaatc AGGAGTGCAAA aagagaaaat 761 1.000000 3-1 483 cggatcactc CGAACCGAGAT tagttaagcc 493 1.000000 4-1 389 acaaagtgca AGCATAGTGGG gccttcttcc 399 1.000000 5-1 125 TTCGtaagag AGAAGAGATGA agttatttgg 135 1.000000 6-1 233 atgtagggac CGAATTGTTTA caagttctct 243 1.000000 7-1 158 TTGACgttaa AGTATAGAGGT atattaacaa 168 1.000000 8-1 344 gctatattga AGTACGGATTA gaagccgccg 354 1.000000 9-1 775 tttattcgaa CGCATAGAGTA cacacactca 785 1.000000 10-1 790 taaTAAGAAt AGGAGGGAATA 800 1.000000 sites: ** * ** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 249 259 254 -w 1.000000 >2 751 761 756 -w 1.000000 >3 483 493 488 -w 1.000000 >4 389 399 394 -w 1.000000 >5 125 135 130 -w 1.000000 >6 233 243 238 -w 1.000000 >7 158 168 163 -w 1.000000 >8 344 354 349 -w 1.000000 >9 775 785 780 -w 1.000000 >10 790 800 795 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 57 38 . . 0.7 2 . . 83 . 1.5 4 94 . . . 1.3 7 . . 93 . 1.9 8 66 . . . 0.5 11 66 . . . 0.5 non- site 30 . 18 . site 50 . 33 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 5 4 . . 7 2 . . 18 . 15 4 15 . . . 13 7 . . 22 . 19 8 7 . . . 5 11 7 . . . 5 site 4 . 3 . 4 Weighted motif model: POS A C G T Prob 1 0.573261 0.381761 0.016568 0.028409 0.721704 2 0.027807 0.109034 0.834750 0.028409 1.543220 4 0.936898 0.018125 0.016568 0.028409 1.294744 7 0.027807 0.018125 0.925659 0.028409 1.913088 8 0.664170 0.109034 0.016568 0.210227 0.470465 11 0.664170 0.018125 0.107477 0.210227 0.478131 Conservedness in bits: 6.421352 Conservedness in prob: 9.329346 Concensus sequence: CGAGAA Complete log-likelihood ratio = 83 bits Missing position information = 60 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.26 bits MOTIF H 1-1 634 Tttctcagcg ATGTTT tgtaggaaat 639 1.000000 2-1 774 gagaaaataa AAGTAA aaaggtaggg 779 1.000000 3-1 755 tagtaatagt TAAGTA aacacaagat 760 1.000000 4-1 594 agtttaattc TAATAT taataatatc 599 1.000000 5-1 93 actactcaat AGGTAA caTGAGAATA 98 1.000000 6-1 12 agaactggaa AGATTG tgtaaccttg 17 1.000000 7-1 244 Ttgaaagtat TAGTTA aagtggttat 249 1.000000 8-1 472 tccgaacaat AAAGAT tctacaatac 477 1.000000 9-1 758 agcaatacaa AGAGAA ttttattcga 763 1.000000 10-1 783 ctacgcataa TAAGAA tAGGAGGGAA 788 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 634 639 636 -w 1.000000 >2 774 779 776 -w 1.000000 >3 755 760 757 -w 1.000000 >4 594 599 596 -w 1.000000 >5 93 98 95 -w 1.000000 >6 12 17 14 -w 1.000000 >7 244 249 246 -w 1.000000 >8 472 477 474 -w 1.000000 >9 758 763 760 -w 1.000000 >10 783 788 785 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 57 . . 39 0.5 2 57 . 29 . 0.5 3 57 . 38 . 0.8 4 . . 38 57 0.7 5 57 . . 39 0.5 6 57 . . . 0.4 non- site 30 . . . site 50 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 5 . . 1 5 2 5 . 2 . 5 3 5 . 4 . 8 4 . . 4 5 7 5 5 . . 1 5 6 5 . . . 4 site 4 . . . 4 Weighted motif model: POS A C G T Prob 1 0.573261 0.018125 0.016568 0.392045 0.527763 2 0.573261 0.018125 0.289295 0.119318 0.483930 3 0.573261 0.018125 0.380205 0.028409 0.761880 4 0.027807 0.018125 0.380205 0.573864 0.747638 5 0.573261 0.018125 0.016568 0.392045 0.527763 6 0.573261 0.018125 0.107477 0.301136 0.358838 Conservedness in bits: 3.407813 Conservedness in prob: 5.746717 Concensus sequence: AAGGAA Complete log-likelihood ratio = 46 bits Missing position information = 39 bits Log-likelihood ratio statistic = 6 bits Degrees of freedom = 18 Information per parameter = 0.372 bits MOTIF I 1-1 619 gccatttttc TTTCCT ttctcagcgA 624 1.000000 2-1 733 ggtattcata CTTCCT attagcggaa 738 1.000000 3-1 278 attcggaaag CTTCCT tccggaatgg 283 1.000000 4-1 616 tatcctatat TTTCTT catttaccgg 621 1.000000 5-1 345 tcatacttcc TGGCTT tagatatttg 350 1.000000 6-1 77 TTTTCCTgat TTGCCA gcttactatc 82 1.000000 7-1 756 aacttctttg CGTCCA tccaaaaaaa 761 1.000000 8-1 404 ctcctccgtg CGTCCT cgtcttcacc 409 1.000000 9-1 531 cattttattg CTGCCT caatctccat 536 1.000000 10-1 520 ctttcaccga TTTCCT agaccggaAA 525 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 619 624 621 -w 1.000000 >2 733 738 735 -w 1.000000 >3 278 283 280 -w 1.000000 >4 616 621 618 -w 1.000000 >5 345 350 347 -w 1.000000 >6 77 82 79 -w 1.000000 >7 756 761 758 -w 1.000000 >8 404 409 406 -w 1.000000 >9 531 536 533 -w 1.000000 >10 520 525 522 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 47 . 48 0.7 2 . . 29 66 0.8 3 . . 29 66 0.8 4 . 93 . . 1.8 5 . 75 . . 1.1 6 . . . 76 0.7 non- site . 19 . 31 site . 38 . 48 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 6 . 3 7 2 . . 2 7 8 3 . . 2 7 8 4 . 21 . . 18 5 . 14 . . 11 6 . . . 10 7 site . 4 . 3 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.472670 0.016568 0.482955 0.738438 2 0.027807 0.018125 0.289295 0.664773 0.757894 3 0.027807 0.018125 0.289295 0.664773 0.757894 4 0.027807 0.927216 0.016568 0.028409 1.804236 5 0.027807 0.745398 0.016568 0.210227 1.144396 6 0.209625 0.018125 0.016568 0.755682 0.728388 Conservedness in bits: 5.931248 Conservedness in prob: 8.817230 Concensus sequence: CTTCCT Complete log-likelihood ratio = 78 bits Missing position information = 59 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.06 bits MOTIF J 1-1 64 gttgaacaag AACAAGAAG ttaatcaaga 72 1.000000 2-1 334 tgacagtaat ATCAAACAG tgacacatat 342 1.000000 3-1 14 taattttgct TCCAAGACG acagtaatat 22 1.000000 4-1 77 tgggtttgtc TTCAATACG gcagccgttg 85 1.000000 5-1 110 aTGAGAATAT TTCAGTTCG taagagAGAA 118 1.000000 6-1 721 aagatataaa AGCAGGTCG gaaatattta 729 1.000000 7-1 629 tactgaaagt TCCAAAGAG aaggtttttt 637 1.000000 8-1 148 ttgaattttc AAAAATTCT tacTTTTTTT 156 1.000000 9-1 633 TTTTTTTatt AAAAAACAG catggagttt 641 1.000000 10-1 534 CTagaccgga AAAAAGTCG tatgacatca 542 1.000000 sites: * *** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 64 72 68 -w 1.000000 >2 334 342 338 -w 1.000000 >3 14 22 18 -w 1.000000 >4 77 85 81 -w 1.000000 >5 110 118 114 -w 1.000000 >6 721 729 725 -w 1.000000 >7 629 637 633 -w 1.000000 >8 148 156 152 -w 1.000000 >9 633 641 637 -w 1.000000 >10 534 542 538 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 57 . . 39 0.5 3 . 65 . . 1.0 4 94 . . . 1.3 5 76 . . . 0.8 8 39 56 . . 0.8 9 . . 83 . 1.5 non- site 30 . . . site 51 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 5 . . 1 5 3 . 11 . . 10 4 15 . . . 13 5 10 . . . 8 8 1 8 . . 8 9 . . 18 . 15 site 4 . . . 3 Weighted motif model: POS A C G T Prob 1 0.573261 0.018125 0.016568 0.392045 0.527763 3 0.300534 0.654489 0.016568 0.028409 0.959138 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.755080 0.018125 0.198386 0.028409 0.847687 8 0.391443 0.563580 0.016568 0.028409 0.828585 9 0.027807 0.018125 0.834750 0.119318 1.507995 Conservedness in bits: 5.965913 Conservedness in prob: 9.234330 Concensus sequence: ACAACG Complete log-likelihood ratio = 78 bits Missing position information = 57 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.15 bits seed 2 time: 7 seconds (0.12 minutes) MOTIF A 1-1 697 gaatttcaca GATCGATA tgctttggtg 704 1.000000 2-1 1 ATGCTAAA tcatttggct 8 1.000000 3-1 780 ttaacataat AAAAAAAA taattctttc 787 1.000000 4-1 476 cttcttcact ATAAGAAA atcacacgag 483 1.000000 5-1 645 ccgagctttc AGGAAAAG actacggcag 652 1.000000 6-1 5 gaga ACTGGAAA gattgtgtaa 12 1.000000 7-1 208 tgacatttga ATAAGAAG taatacaaAC 215 1.000000 8-1 785 tttaacgtca AGGAGAAA aaactata 792 1.000000 9-1 418 aattcatcgt GAGAGAAA atacgagtcc 425 1.000000 10-1 578 aagttagaca AGGACAAA atcaggacaa 585 1.000000 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 697 704 700 -w 1.000000 >2 1 8 4 -w 1.000000 >3 780 787 783 -w 1.000000 >4 476 483 479 -w 1.000000 >5 645 652 648 -w 1.000000 >6 5 12 8 -w 1.000000 >7 208 215 211 -w 1.000000 >8 785 792 788 -w 1.000000 >9 418 425 421 -w 1.000000 >10 578 585 581 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.8 4 66 . . . 0.6 5 . . 56 . 0.5 6 94 . . . 1.3 7 85 . . . 1.0 8 76 . . . 0.8 non- site 30 . . . site 73 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 8 4 7 . . . 6 5 . . 9 . 5 6 15 . . . 13 7 12 . . . 10 8 10 . . . 8 site 9 . . . 7 Weighted motif model: POS A C G T Prob 1 0.755080 0.018125 0.198386 0.028409 0.847687 4 0.664170 0.199943 0.107477 0.028409 0.563605 5 0.209625 0.109034 0.562023 0.119318 0.538176 6 0.936898 0.018125 0.016568 0.028409 1.294744 7 0.845989 0.018125 0.016568 0.119318 0.955898 8 0.755080 0.018125 0.198386 0.028409 0.847687 Conservedness in bits: 5.047796 Conservedness in prob: 8.433339 Concensus sequence: AAGAAA Complete log-likelihood ratio = 66 bits Missing position information = 44 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.23 bits MOTIF B 1-1 455 gattaataca TATCTCCATCT ttttaaatac 465 1.000000 2-1 151 ttgctagcct TTTCTCGGTCT tgcaaacaac 161 1.000000 3-1 193 gcactcaact TGTAACTGGCA actactttgc 203 1.000000 4-1 777 cgatagttgg TTTCCCGTTCT ttccactccc 787 1.000000 5-1 51 ataaaatttt TCACTCTTTCT gcgcgcgcca 61 1.000000 6-1 356 ttacttttga TATCACTCACA actattgcga 366 1.000000 7-1 558 gtcggagggc TGTCGCCCGCT cggcggcttc 568 1.000000 8-1 684 ataaccactt TAACTAATACT ttcaacattt 694 1.000000 9-1 204 GCTCctccac TAAAACGATCA gcaaatggca 214 1.000000 10-1 667 aaatctctgt TCTCTCTTACT tatatgatga 677 1.000000 sites: * ** * ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 455 465 460 -w 1.000000 >2 151 161 156 -w 1.000000 >3 193 203 198 -w 1.000000 >4 777 787 782 -w 1.000000 >5 51 61 56 -w 1.000000 >6 356 366 361 -w 1.000000 >7 558 568 563 -w 1.000000 >8 684 694 689 -w 1.000000 >9 204 214 209 -w 1.000000 >10 667 677 672 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 3 . . . 66 0.6 4 . 75 . . 1.1 6 . 84 . . 1.4 10 . 93 . . 1.8 11 . . . 66 0.6 non- site . 19 . 31 site . 45 . 40 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 3 . . . 7 6 4 . 14 . . 11 6 . 17 . . 14 10 . 21 . . 18 11 . . . 7 6 site . 5 . 1 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.300534 0.018125 0.016568 0.664773 0.596285 4 0.209625 0.745398 0.016568 0.028409 1.148270 6 0.118716 0.836307 0.016568 0.028409 1.412247 10 0.027807 0.927216 0.016568 0.028409 1.804236 11 0.300534 0.018125 0.016568 0.664773 0.596285 Conservedness in bits: 6.827009 Conservedness in prob: 9.951467 Concensus sequence: TTCCCT Complete log-likelihood ratio = 89 bits Missing position information = 71 bits Log-likelihood ratio statistic = 17 bits Degrees of freedom = 18 Information per parameter = 0.965 bits MOTIF C 1-1 570 cgggaagctc GGAGTA tatTGCACCG 575 1.000000 2-1 643 cacataggca GTAAAA tttttactga 648 1.000000 3-1 522 ctcaagatgg GGAGCA aatggcatta 527 1.000000 4-1 328 atagagagaa GGAGCA agcaactgac 333 1.000000 5-1 695 tataaaaccg GGAGAA tcaagacaTT 700 1.000000 6-1 523 gctatacttc GGAGCA ctgttgagcg 528 1.000000 7-1 533 gaggacgcac GGAGGA gagtcttccg 538 1.000000 8-1 176 tttggatgga CGCAAA gaagtttaat 181 1.000000 9-1 464 ccgtagacat GGAATA tctgccattc 469 1.000000 10-1 744 cataccccat AGAGAA gatctttcgg 749 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 570 575 572 -w 1.000000 >2 643 648 645 -w 1.000000 >3 522 527 524 -w 1.000000 >4 328 333 330 -w 1.000000 >5 695 700 697 -w 1.000000 >6 523 528 525 -w 1.000000 >7 533 538 535 -w 1.000000 >8 176 181 178 -w 1.000000 >9 464 469 466 -w 1.000000 >10 744 749 746 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 74 . 1.2 2 . . 83 . 1.5 3 85 . . . 1.0 4 . . 65 . 1.0 5 39 29 . . 0.1 6 94 . . . 1.3 non- site 30 . 18 . site 45 . 41 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 15 . 12 2 . . 18 . 15 3 12 . . . 10 4 . . 12 . 10 5 1 2 . . 1 6 15 . . . 13 site 3 . 5 . 5 Weighted motif model: POS A C G T Prob 1 0.118716 0.109034 0.743841 0.028409 1.153995 2 0.027807 0.018125 0.834750 0.119318 1.507995 3 0.845989 0.109034 0.016568 0.028409 0.991122 4 0.300534 0.018125 0.652932 0.028409 1.033437 5 0.391443 0.290852 0.107477 0.210227 0.095640 6 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.076934 Conservedness in prob: 9.692962 Concensus sequence: GGAGCA Complete log-likelihood ratio = 78 bits Missing position information = 69 bits Log-likelihood ratio statistic = 9 bits Degrees of freedom = 18 Information per parameter = 0.523 bits MOTIF D 1-1 64 gttgaacaag AACAAGAAG ttaatcaaga 72 1.000000 2-1 768 caaaaagaga AAATAAAAG taaaaaggta 776 1.000000 3-1 760 atagttaagt AAACACAAG attaacataa 768 1.000000 4-1 678 cattcataat AACCAAAAG ctcataactt 686 1.000000 5-1 452 TATTCCGGGG AAGAACAAG gaagggcggt 460 1.000000 6-1 399 aaaaaatcat AAGGAAAAG ttgtaaatat 407 1.000000 7-1 238 AAAAtgttga AAGTATTAG ttaaagtggt 246 1.000000 8-1 661 agatatataa ATGGAAAAG ctgcataacc 669 1.000000 9-1 738 tcaatagcga AACCACAAG cagcaataca 746 1.000000 10-1 501 agataggaaa AAAAAAAAG ctttcaccga 509 1.000000 sites: ** * *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 64 72 68 -w 1.000000 >2 768 776 772 -w 1.000000 >3 760 768 764 -w 1.000000 >4 678 686 682 -w 1.000000 >5 452 460 456 -w 1.000000 >6 399 407 403 -w 1.000000 >7 238 246 242 -w 1.000000 >8 661 669 665 -w 1.000000 >9 738 746 742 -w 1.000000 >10 501 509 505 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 85 . . . 1.0 5 94 . . . 1.3 7 85 . . . 1.0 8 94 . . . 1.3 9 . . 93 . 1.9 non- site 30 . . . site 80 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 12 . . . 10 5 15 . . . 13 7 12 . . . 10 8 15 . . . 13 9 . . 22 . 19 site 11 . . . 10 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.845989 0.018125 0.016568 0.119318 0.955898 5 0.936898 0.018125 0.016568 0.028409 1.294744 7 0.845989 0.018125 0.016568 0.119318 0.955898 8 0.936898 0.018125 0.016568 0.028409 1.294744 9 0.027807 0.018125 0.925659 0.028409 1.913088 Conservedness in bits: 7.709116 Conservedness in prob: 10.124802 Concensus sequence: AAAAAG Complete log-likelihood ratio = 100 bits Missing position information = 72 bits Log-likelihood ratio statistic = 28 bits Degrees of freedom = 18 Information per parameter = 1.6 bits MOTIF E 1-1 778 aggtattcca TGCGCAAA tagattactt 785 1.000000 2-1 33 gattgattgt ACAGGAAA atatacatcg 40 1.000000 3-1 327 ttctattagt AGCTAAAA atgggtcacg 334 1.000000 4-1 450 acggaaaacc AACCTAAA ggtattaact 457 1.000000 5-1 121 tcAGTTCGTA AGAGAGAA gagatgaagt 128 1.000000 6-1 287 attgaaaatc TATGGAAA gatatggacg 294 1.000000 7-1 224 AGtaatacaa ACTGAAAA tgttgaAAGT 231 1.000000 8-1 746 taaaagtatc AACAAAAA attgttaata 753 1.000000 9-1 317 ccctagaaca AGCGGGAA aaaggtccgg 324 1.000000 10-1 30 taactttagc ATCACAAA atacgcaata 37 1.000000 sites: * ** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 778 785 781 -w 1.000000 >2 33 40 36 -w 1.000000 >3 327 334 330 -w 1.000000 >4 450 457 453 -w 1.000000 >5 121 128 124 -w 1.000000 >6 287 294 290 -w 1.000000 >7 224 231 227 -w 1.000000 >8 746 753 749 -w 1.000000 >9 317 324 320 -w 1.000000 >10 30 37 33 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.7 3 . 56 . . 0.6 4 . . 56 . 0.5 6 76 . . . 0.8 7 94 . . . 1.3 8 94 . . . 1.3 non- site 30 . . . site 66 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 7 3 . 8 . . 6 4 . . 9 . 5 6 10 . . . 8 7 15 . . . 13 8 15 . . . 13 site 7 . . . 4 Weighted motif model: POS A C G T Prob 1 0.755080 0.018125 0.016568 0.210227 0.744138 3 0.209625 0.563580 0.016568 0.210227 0.553062 4 0.209625 0.109034 0.562023 0.119318 0.538176 6 0.755080 0.018125 0.198386 0.028409 0.847687 7 0.936898 0.018125 0.016568 0.028409 1.294744 8 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 5.272551 Conservedness in prob: 8.961116 Concensus sequence: ACGAAA Complete log-likelihood ratio = 69 bits Missing position information = 52 bits Log-likelihood ratio statistic = 16 bits Degrees of freedom = 18 Information per parameter = 0.925 bits MOTIF F 1-1 749 tattatataa TCTTCGAC tcgcataata 756 1.000000 2-1 314 TTTactatta TCTTCTAC gctgacagta 321 1.000000 3-1 352 acgtgatcta TATTCGAA aggggcggtt 359 1.000000 4-1 615 atatcctata TTTTCTTC atttaccggc 622 1.000000 5-1 113 agaatatttc AGTTCGTA AGAGAGAAga 120 1.000000 6-1 650 ggctatacag TGTTCACA aaatagccaa 657 1.000000 7-1 419 tactgccaat TTTTCCTC ttcataacca 426 1.000000 8-1 540 gccccacaaa CCTTCAAA ttaacgaatc 547 1.000000 9-1 767 aagagaattt TATTCGAA cgcatagagt 774 1.000000 10-1 641 caatttgccc TTTTCCAT tttccattaa 648 1.000000 sites: * *** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 749 756 752 -w 1.000000 >2 314 321 317 -w 1.000000 >3 352 359 355 -w 1.000000 >4 615 622 618 -w 1.000000 >5 113 120 116 -w 1.000000 >6 650 657 653 -w 1.000000 >7 419 426 422 -w 1.000000 >8 540 547 543 -w 1.000000 >9 767 774 770 -w 1.000000 >10 641 648 644 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 76 0.6 3 . . . 94 1.3 4 . . . 94 1.3 5 . 93 . . 1.8 7 57 . . . 0.4 8 48 38 . . 0.5 non- site . 19 . 31 site . 26 . 53 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 10 6 3 . . . 15 13 4 . . . 15 13 5 . 21 . . 18 7 5 . . . 4 8 3 4 . . 5 site . 1 . 4 4 Weighted motif model: POS A C G T Prob 1 0.118716 0.109034 0.016568 0.755682 0.648329 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.927216 0.016568 0.028409 1.804236 7 0.573261 0.109034 0.016568 0.301136 0.351173 8 0.482352 0.381761 0.016568 0.119318 0.451703 Conservedness in bits: 5.794817 Conservedness in prob: 8.504706 Concensus sequence: TTTCAC Complete log-likelihood ratio = 75 bits Missing position information = 60 bits Log-likelihood ratio statistic = 15 bits Degrees of freedom = 18 Information per parameter = 0.856 bits MOTIF G 1-1 351 acttctttgt TTCTTTGTTGAA gaagaactgg 362 1.000000 2-1 566 gtggaattct TGAAAGAATGAA atcgccatgc 577 1.000000 3-1 672 atataaacaa TCAGTAATTGGA ttgaaaattt 683 1.000000 4-1 15 ctttacgttt TGACTTGGTGCT cgaagatgct 26 1.000000 5-1 619 ctctccttaa TTCCCTAGAGTA gaaaccgagc 630 1.000000 6-1 676 aagctgaaaa TAATGTGTAGCT atgttcagtt 687 1.000000 7-1 303 caaaaatcat CGCTTCGCTGAT taattacccc 314 1.000000 8-1 624 aattaatcag CGAAGCGATGAT ttttgatcta 635 1.000000 9-1 146 acttggactt TTCTCTATTGTA aagcggaaaa 157 1.000000 10-1 97 aactacttaa TAAATGATTGTA tgataatgtt 108 1.000000 sites: * * * ** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 351 362 356 -w 1.000000 >2 566 577 571 -w 1.000000 >3 672 683 677 -w 1.000000 >4 15 26 20 -w 1.000000 >5 619 630 624 -w 1.000000 >6 676 687 681 -w 1.000000 >7 303 314 308 -w 1.000000 >8 624 635 629 -w 1.000000 >9 146 157 151 -w 1.000000 >10 97 108 102 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 76 0.8 3 57 38 . . 0.7 7 48 . 47 . 0.8 9 . . . 76 0.7 10 . . 93 . 1.9 12 57 . . 39 0.5 non- site . . 18 . site . . 25 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 10 8 3 5 4 . . 7 7 3 . 6 . 8 9 . . . 10 7 10 . . 22 . 19 12 5 . . 1 5 site . . 1 . 1 Weighted motif model: POS A C G T Prob 1 0.027807 0.199943 0.016568 0.755682 0.809989 3 0.573261 0.381761 0.016568 0.028409 0.721704 7 0.482352 0.018125 0.471114 0.028409 0.801493 9 0.209625 0.018125 0.016568 0.755682 0.728388 10 0.027807 0.018125 0.925659 0.028409 1.913088 12 0.573261 0.018125 0.016568 0.392045 0.527763 Conservedness in bits: 5.502426 Conservedness in prob: 8.106001 Concensus sequence: TCGTGA Complete log-likelihood ratio = 72 bits Missing position information = 58 bits Log-likelihood ratio statistic = 14 bits Degrees of freedom = 18 Information per parameter = 0.81 bits MOTIF H 1-1 160 gggtcctcaa TTGTCCAAGGCTGGT aagttcccaa 174 1.000000 2-1 292 tcaaatacac TTATTAACCGCTTTT actattaTCT 306 1.000000 3-1 587 ttatacaaca TTCTGGAGAGCTATT gttcaaaaaa 601 1.000000 4-1 187 tgggtatggc TTGGGCAAGTGTCTT tttatgtatc 201 1.000000 5-1 709 AAtcaagaca TTCTAATGACTTGAT tcaggatgag 723 1.000000 6-1 470 cccctttatt TTGTTCATACATTCT taaattgctt 484 1.000000 7-1 449 aaagctagta TTGTAGAATCTTTAT tgttcggagc 463 1.000000 8-1 239 atatctaatc TTACTTATATGTTGT ggaaatgtaa 253 1.000000 9-1 15 tctatgtaca TTGCCAAGGTTTTCT actgatcaat 29 1.000000 10-1 597 tcaggacaaa TTGTAAAGATATAAT aaactatttg 611 1.000000 sites: ** * * * * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 160 174 167 -w 1.000000 >2 292 306 299 -w 1.000000 >3 587 601 594 -w 1.000000 >4 187 201 194 -w 1.000000 >5 709 723 716 -w 1.000000 >6 470 484 477 -w 1.000000 >7 449 463 456 -w 1.000000 >8 239 253 246 -w 1.000000 >9 15 29 22 -w 1.000000 >10 597 611 604 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 4 . . . 66 0.5 7 85 . . . 1.0 12 . . . 94 1.3 15 . . . 94 1.3 non- site . . . 31 site . . . 80 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 4 . . . 7 5 7 12 . . . 10 12 . . . 15 13 15 . . . 15 13 site . . . 11 8 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.199943 0.107477 0.664773 0.546680 7 0.845989 0.018125 0.016568 0.119318 0.955898 12 0.027807 0.018125 0.016568 0.937500 1.269688 15 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.581329 Conservedness in prob: 8.896551 Concensus sequence: TTTATT Complete log-likelihood ratio = 87 bits Missing position information = 62 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.38 bits MOTIF I 1-1 579 cGGAGTAtat TGCACCGATC cgattcttac 588 1.000000 2-1 481 cgagatccgt TTAACCGGAC cctagtgcac 490 1.000000 3-1 395 cggcggtctt TCGTCCGTGC ggagatatct 404 1.000000 4-1 415 cttccaatgc TAATCCGGTC actgccactg 424 1.000000 5-1 442 cggggcagac TATTCCGGGG AAGAACAAGg 451 1.000000 6-1 626 ctgttgaccg TGATCCGAAG gactggctat 635 1.000000 7-1 579 cggcggcttc TAATCCGTAC ttcaatatag 588 1.000000 8-1 395 cggaagactc TCCTCCGTGC gtcctcgtct 404 1.000000 9-1 188 ccccgccccc TCCTCCGCTC ctccacTAAA 197 1.000000 10-1 364 GTCCTTTTTT TTTTCCGGGG actctacgag 373 1.000000 sites: * **** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 579 588 583 -w 1.000000 >2 481 490 485 -w 1.000000 >3 395 404 399 -w 1.000000 >4 415 424 419 -w 1.000000 >5 442 451 446 -w 1.000000 >6 626 635 630 -w 1.000000 >7 579 588 583 -w 1.000000 >8 395 404 399 -w 1.000000 >9 188 197 192 -w 1.000000 >10 364 373 368 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 4 . . . 76 0.7 5 . 93 . . 1.8 6 . 93 . . 1.8 7 . . 93 . 1.9 10 . 65 29 . 1.1 non- site . 19 18 . site . 45 21 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 4 . . . 10 7 5 . 21 . . 18 6 . 21 . . 18 7 . . 22 . 19 10 . 11 2 . 11 site . 5 1 . 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.209625 0.018125 0.016568 0.755682 0.728388 5 0.027807 0.927216 0.016568 0.028409 1.804236 6 0.027807 0.927216 0.016568 0.028409 1.804236 7 0.027807 0.018125 0.925659 0.028409 1.913088 10 0.027807 0.654489 0.289295 0.028409 1.120748 Conservedness in bits: 8.640385 Conservedness in prob: 11.353173 Concensus sequence: TTCCGC Complete log-likelihood ratio = 112 bits Missing position information = 80 bits Log-likelihood ratio statistic = 32 bits Degrees of freedom = 18 Information per parameter = 1.79 bits MOTIF J 1-1 406 taagtcctcc ATGGGTCCAGCTTTCAGATTGT actaatcact 427 1.000000 2-1 700 ggcaacacct TTGTTACCACATTGACAACCCC aggtattcat 721 1.000000 3-1 717 gctcttcatt ATGCACCTTATTCAATTATCAT caagaatagt 738 1.000000 4-1 703 actttttttt TTGAACCTGAATATATATACAT cacatatcac 724 1.000000 5-1 744 agcttaatag GTGCATCTTAGCAAGCTAAAAT ttggacagct 765 1.000000 6-1 35 ttgaaaaacg GTGAAACTTACGGGTCCAAGAT tgtctacaga 56 1.000000 7-1 660 ggctaagata ATGGGGCTCTTTACATTTCCAC aacatataag 681 1.000000 8-1 300 aaccttctct TTGGAACTTTCAGTAATACGCT taactgctca 321 1.000000 9-1 604 aaactttgta ATGCGCCTGTAACTGCTTCTTT ttttattaaa 625 1.000000 10-1 342 gattgccgtc TTGAAACTTTTTGTCCTTTTTT TTTTCCGGGG 363 1.000000 sites: *** * * * 5 10 15 20 (10 sites in 10 sequences) Conservedness in sites: >1 406 427 416 -w 1.000000 >2 700 721 710 -w 1.000000 >3 717 738 727 -w 1.000000 >4 703 724 713 -w 1.000000 >5 744 765 754 -w 1.000000 >6 35 56 45 -w 1.000000 >7 660 681 670 -w 1.000000 >8 300 321 310 -w 1.000000 >9 604 625 614 -w 1.000000 >10 342 363 352 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 39 . . 39 0.2 2 . . . 94 1.3 3 . . 93 . 1.9 7 . 93 . . 1.8 18 57 . . 39 0.5 22 . . . 76 0.8 non- site . . . 31 site . . . 43 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 1 . . 1 2 2 . . . 15 13 3 . . 22 . 19 7 . 21 . . 18 18 5 . . 1 5 22 . . . 10 8 site . . . 2 1 Weighted motif model: POS A C G T Prob 1 0.391443 0.018125 0.198386 0.392045 0.229142 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.925659 0.028409 1.913088 7 0.027807 0.927216 0.016568 0.028409 1.804236 18 0.573261 0.018125 0.016568 0.392045 0.527763 22 0.027807 0.199943 0.016568 0.755682 0.809989 Conservedness in bits: 6.553906 Conservedness in prob: 8.682980 Concensus sequence: ATGCAT Complete log-likelihood ratio = 85 bits Missing position information = 63 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.24 bits seed 3 time: 6 seconds (0.10 minutes) MOTIF A 1-1 173 tccaaggctg GTAAGTTCCC aaccccagtt 182 1.000000 2-1 103 ttgttgaaga GAATGTTCAC aggcgcatAC 112 1.000000 3-1 549 actcctgcta GAAAGTTAAC tgtgcacata 558 1.000000 4-1 633 atttaccggc GCACTCTCGC ccgaacgacc 642 1.000000 5-1 539 aatctagcac GCAGATTGCA aacacggctt 548 1.000000 6-1 614 gcgctcggac AACTGTTGAC cgtgatccga 623 1.000000 7-1 571 cgcccgctcg GCGGCTTCTA atccgtactt 580 1.000000 8-1 104 aattttagaa GTACTTTCAC tttgtaactg 113 1.000000 9-1 116 taacatcaag GCCATCTCAC gccgagactt 125 1.000000 10-1 251 ttgtacgtgg GGCAGTTGAC gtcttatcat 260 1.000000 sites: * * *** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 173 182 177 -w 1.000000 >2 103 112 107 -w 1.000000 >3 549 558 553 -w 1.000000 >4 633 642 637 -w 1.000000 >5 539 548 543 -w 1.000000 >6 614 623 618 -w 1.000000 >7 571 580 575 -w 1.000000 >8 104 113 108 -w 1.000000 >9 116 125 120 -w 1.000000 >10 251 260 255 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 83 . 1.5 3 57 29 . . 0.5 6 . . . 76 0.8 7 . . . 94 1.3 8 . 56 29 . 0.8 10 . 75 . . 1.1 non- site . 19 18 . site . 31 21 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 18 . 15 3 5 2 . . 5 6 . . . 10 8 7 . . . 15 13 8 . 8 2 . 8 10 . 14 . . 11 site . 2 1 . 1 Weighted motif model: POS A C G T Prob 1 0.118716 0.018125 0.834750 0.028409 1.509552 3 0.573261 0.290852 0.107477 0.028409 0.497811 6 0.027807 0.199943 0.016568 0.755682 0.809989 7 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.118716 0.563580 0.289295 0.028409 0.777356 10 0.209625 0.745398 0.016568 0.028409 1.148270 Conservedness in bits: 6.012664 Conservedness in prob: 9.362222 Concensus sequence: GATTCC Complete log-likelihood ratio = 78 bits Missing position information = 62 bits Log-likelihood ratio statistic = 15 bits Degrees of freedom = 18 Information per parameter = 0.884 bits MOTIF B 1-1 547 tttgggcccg GAATAT atcttttcgg 552 1.000000 2-1 27 ctttttgatt GATTGT ACAGGAAAAT 32 1.000000 3-1 41 atgtctccta CAATAC cagtttcgct 46 1.000000 4-1 711 ttttgaacct GAATAT atatacatca 716 1.000000 5-1 104 ggtaacatga GAATAT ttcagttcgt 109 1.000000 6-1 315 gtagcaacaa GAATAT agcacgagcc 320 1.000000 7-1 793 TTTGAAAATT CAATAT aa 798 1.000000 8-1 140 catttatatt GAATTT tcaaaAATTC 145 1.000000 9-1 602 tcaaactttg TAATGC gcctgtaact 607 1.000000 10-1 786 cgcataataa GAATAG gagggaata 791 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 547 552 549 -w 1.000000 >2 27 32 29 -w 1.000000 >3 41 46 43 -w 1.000000 >4 711 716 713 -w 1.000000 >5 104 109 106 -w 1.000000 >6 315 320 317 -w 1.000000 >7 793 798 795 -w 1.000000 >8 140 145 142 -w 1.000000 >9 602 607 604 -w 1.000000 >10 786 791 788 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 65 . 0.9 2 94 . . . 1.3 3 85 . . . 1.0 4 . . . 94 1.3 5 66 . . . 0.5 6 . . . 66 0.5 non- site 30 . . . site 43 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 12 . 9 2 15 . . . 13 3 12 . . . 10 4 . . . 15 13 5 7 . . . 5 6 . . . 7 5 site 2 . . . 1 Weighted motif model: POS A C G T Prob 1 0.027807 0.199943 0.652932 0.119318 0.940943 2 0.936898 0.018125 0.016568 0.028409 1.294744 3 0.845989 0.018125 0.016568 0.119318 0.955898 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.664170 0.018125 0.198386 0.119318 0.538790 6 0.027807 0.199943 0.107477 0.664773 0.546680 Conservedness in bits: 5.546743 Conservedness in prob: 8.716238 Concensus sequence: GAATAT Complete log-likelihood ratio = 72 bits Missing position information = 50 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.24 bits MOTIF C 1-1 502 gactctaagt AGTAAAAGTATTA tgcatagttt 514 1.000000 2-1 33 gattGATTGT ACAGGAAAATATA catcgcaggg 45 1.000000 3-1 609 attgttcaaa AAACAAACATTTC gcaggctaaa 621 1.000000 4-1 364 ctgccactgg ACCTGAAGACATG caacaaagtg 376 1.000000 5-1 734 tcaggatgag AGCTTAATAGGTG catcttagca 746 1.000000 6-1 773 aacatgataa AAAAAAACAGTTG aatattccct 785 1.000000 7-1 224 agtaatacaa ACTGAAAATGTTG aaagtattag 236 1.000000 8-1 660 cagatatata AATGGAAAAGCTG cataaccact 672 1.000000 9-1 673 aaggaaacat ACAAAAAGATTTG ttcatttcac 685 1.000000 10-1 454 aagcgcgagg AGGAAAAGAAATG acagaaaaat 466 1.000000 sites: * ** * ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 502 514 508 -w 1.000000 >2 33 45 39 -w 1.000000 >3 609 621 615 -w 1.000000 >4 364 376 370 -w 1.000000 >5 734 746 740 -w 1.000000 >6 773 785 779 -w 1.000000 >7 224 236 230 -w 1.000000 >8 660 672 666 -w 1.000000 >9 673 685 679 -w 1.000000 >10 454 466 460 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 6 94 . . . 1.3 7 94 . . . 1.3 9 76 . . . 0.7 12 . . . 94 1.3 13 . . 65 . 0.9 non- site 30 . . . site 66 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 6 15 . . . 13 7 15 . . . 13 9 10 . . . 7 12 . . . 15 13 13 . . 12 . 9 site 7 . . . 5 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.936898 0.018125 0.016568 0.028409 1.294744 7 0.936898 0.018125 0.016568 0.028409 1.294744 9 0.755080 0.018125 0.016568 0.210227 0.744138 12 0.027807 0.018125 0.016568 0.937500 1.269688 13 0.209625 0.109034 0.652932 0.028409 0.894567 Conservedness in bits: 6.792626 Conservedness in prob: 9.574511 Concensus sequence: AAAATG Complete log-likelihood ratio = 89 bits Missing position information = 64 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.37 bits MOTIF D 1-1 64 gttgaacaag AACAAGAA gttaatcaag 71 1.000000 2-1 570 aattcttgaa AGAATGAA atcgccatgc 577 1.000000 3-1 737 ttcaattatc ATCAAGAA tagtaatagt 744 1.000000 4-1 283 tcgacaattc AAGATACA gaacctcctc 290 1.000000 5-1 38 tctatattcc ACTATAAA atttttcact 45 1.000000 6-1 394 cagtgaaaaa ATCATAAG gaaaagTTGT 401 1.000000 7-1 769 ccatccaaaa AAAAAGTA agaatTTTTG 776 1.000000 8-1 505 tatggttatg AAGAGGAA aaattGGCAG 512 1.000000 9-1 273 acccagtcat ACTATGAA gtccctaaaa 280 1.000000 10-1 498 agaagatagg AAAAAAAA aaagctttca 505 1.000000 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 64 71 67 -w 1.000000 >2 570 577 573 -w 1.000000 >3 737 744 740 -w 1.000000 >4 283 290 286 -w 1.000000 >5 38 45 41 -w 1.000000 >6 394 401 397 -w 1.000000 >7 769 776 772 -w 1.000000 >8 505 512 508 -w 1.000000 >9 273 280 276 -w 1.000000 >10 498 505 501 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 4 94 . . . 1.3 5 39 . . 48 0.3 6 39 . 56 . 0.9 7 76 . . . 0.7 8 85 . . . 1.0 non- site 30 . . . site 75 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 4 15 . . . 13 5 1 . . 3 3 6 1 . 9 . 9 7 10 . . . 7 8 12 . . . 10 site 10 . . . 7 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.391443 0.018125 0.107477 0.482955 0.298022 6 0.391443 0.018125 0.562023 0.028409 0.891441 7 0.755080 0.109034 0.016568 0.119318 0.666396 8 0.845989 0.018125 0.107477 0.028409 0.998787 Conservedness in bits: 5.444135 Conservedness in prob: 8.254022 Concensus sequence: AATGAA Complete log-likelihood ratio = 72 bits Missing position information = 48 bits Log-likelihood ratio statistic = 23 bits Degrees of freedom = 18 Information per parameter = 1.3 bits MOTIF E 1-1 463 CATATctcca TCTTTT taaatacctt 468 1.000000 2-1 362 ttaaacacag TGGTTT ctttgcataa 367 1.000000 3-1 280 TCGGAAAGCT TCCTTC cggaatggct 285 1.000000 4-1 561 tatacccctt TCTTCT ctcccctgca 566 1.000000 5-1 473 agggcggtct TTTCTC cctcattgtc 478 1.000000 6-1 455 gagggggtaa TTTTTC ccctttattt 460 1.000000 7-1 139 tcattatagt TTTTTC tccttgacgt 144 1.000000 8-1 162 ATTCTTActt TTTTTT tggatggacg 167 1.000000 9-1 623 taactgcttc TTTTTT tattaaaaaa 628 1.000000 10-1 363 tgtccttttt TTTTTC cggggactct 368 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 463 468 465 -w 1.000000 >2 362 367 364 -w 1.000000 >3 280 285 282 -w 1.000000 >4 561 566 563 -w 1.000000 >5 473 478 475 -w 1.000000 >6 455 460 457 -w 1.000000 >7 139 144 141 -w 1.000000 >8 162 167 164 -w 1.000000 >9 623 628 625 -w 1.000000 >10 363 368 365 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . 29 . 57 0.5 3 . . . 76 0.7 4 . . . 85 1.0 5 . . . 85 1.0 6 . 47 . 48 0.7 non- site . . . 31 site . . . 78 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . 2 . 5 5 3 . . . 10 7 4 . . . 12 10 5 . . . 12 10 6 . 6 . 3 7 site . . . 10 9 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.290852 0.107477 0.573864 0.483569 3 0.027807 0.109034 0.107477 0.755682 0.689662 4 0.027807 0.109034 0.016568 0.846591 0.968787 5 0.027807 0.109034 0.016568 0.846591 0.968787 6 0.027807 0.472670 0.016568 0.482955 0.738438 Conservedness in bits: 5.118932 Conservedness in prob: 7.856705 Concensus sequence: TTTTTC Complete log-likelihood ratio = 68 bits Missing position information = 55 bits Log-likelihood ratio statistic = 12 bits Degrees of freedom = 18 Information per parameter = 0.689 bits MOTIF F 1-1 195 ccccagtttc TCACAACGATGAC ttgtacggta 207 1.000000 2-1 121 ACaggcgcat ACGCTACAATGAC ccgattcttg 133 1.000000 3-1 80 ctattacatt TACTGAGCATAAC gggctgtact 92 1.000000 4-1 51 gagatggtgc TTATCCTCATGTC ttttgggttt 63 1.000000 5-1 228 TTTTTTtttt TTGGAAGTATGAC ctctgttaaa 240 1.000000 6-1 408 TAAGgaaaag TTGTAAATATTAT tggtagtatt 420 1.000000 7-1 609 caatgagcag TTAAGCGTATTAC tgaaagttcc 621 1.000000 8-1 595 gattagtttt TTAGCCTTATTTC tggggtaatt 607 1.000000 9-1 357 cgtgcgagtt TTGTTAGGATGAC tgccccacac 369 1.000000 10-1 11 tctcattttt TTCTACTCATAAC tttagcatca 23 1.000000 sites: * * ** ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 195 207 201 -w 1.000000 >2 121 133 127 -w 1.000000 >3 80 92 86 -w 1.000000 >4 51 63 57 -w 1.000000 >5 228 240 234 -w 1.000000 >6 408 420 414 -w 1.000000 >7 609 621 615 -w 1.000000 >8 595 607 601 -w 1.000000 >9 357 369 363 -w 1.000000 >10 11 23 17 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 0.9 6 57 38 . . 0.7 9 94 . . . 1.3 10 . . . 94 1.3 12 76 . . . 0.7 13 . 84 . . 1.4 non- site 30 . . 31 site 41 . . 36 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 9 6 5 4 . . 7 9 15 . . . 13 10 . . . 15 13 12 10 . . . 7 13 . 17 . . 14 site 2 . . 1 3 Weighted motif model: POS A C G T Prob 1 0.118716 0.018125 0.016568 0.846591 0.935119 6 0.573261 0.381761 0.016568 0.028409 0.721704 9 0.936898 0.018125 0.016568 0.028409 1.294744 10 0.027807 0.018125 0.016568 0.937500 1.269688 12 0.755080 0.018125 0.016568 0.210227 0.744138 13 0.027807 0.836307 0.016568 0.119318 1.410690 Conservedness in bits: 6.376084 Conservedness in prob: 8.947142 Concensus sequence: TCATAC Complete log-likelihood ratio = 83 bits Missing position information = 55 bits Log-likelihood ratio statistic = 28 bits Degrees of freedom = 18 Information per parameter = 1.56 bits MOTIF G 1-1 644 atgttttgta GGAAATCA cttagaactt 651 1.000000 2-1 639 gcaacacata GGCAGTAA aatttttact 646 1.000000 3-1 460 taaggcagaa GGCAGTAT cggggcggat 467 1.000000 4-1 214 tatgtatcgt GGAATTTA tcctgctggt 221 1.000000 5-1 658 aaaagactac GGCAGTAA agaattgctt 665 1.000000 6-1 729 aaagcaggtc GGAAATAT ttatgggcat 736 1.000000 7-1 45 attatgctcg GGCACTTT tcggccaatg 52 1.000000 8-1 518 AGGAAaaatt GGCAGTAA cctggcccca 525 1.000000 9-1 574 ataaccaaat GACATTTT tcctttcttc 581 1.000000 10-1 41 tcacaaaata CGCAATAA taacgagtag 48 1.000000 sites: **** * * 5 (10 sites in 10 sequences) Conservedness in sites: >1 644 651 647 -w 1.000000 >2 639 646 642 -w 1.000000 >3 460 467 463 -w 1.000000 >4 214 221 217 -w 1.000000 >5 658 665 661 -w 1.000000 >6 729 736 732 -w 1.000000 >7 45 52 48 -w 1.000000 >8 518 525 521 -w 1.000000 >9 574 581 577 -w 1.000000 >10 41 48 44 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 83 . 1.5 2 . . 83 . 1.5 3 . 65 . . 1.0 4 94 . . . 1.3 6 . . . 94 1.3 8 57 . . 39 0.5 non- site . . 18 . site . . 30 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 18 . 15 2 . . 18 . 15 3 . 11 . . 10 4 15 . . . 13 6 . . . 15 13 8 5 . . 1 5 site . . 2 . 1 Weighted motif model: POS A C G T Prob 1 0.027807 0.109034 0.834750 0.028409 1.543220 2 0.118716 0.018125 0.834750 0.028409 1.509552 3 0.300534 0.654489 0.016568 0.028409 0.959138 4 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.573261 0.018125 0.016568 0.392045 0.527763 Conservedness in bits: 7.104105 Conservedness in prob: 10.211897 Concensus sequence: GGCATA Complete log-likelihood ratio = 92 bits Missing position information = 64 bits Log-likelihood ratio statistic = 28 bits Degrees of freedom = 18 Information per parameter = 1.57 bits MOTIF H 1-1 452 agcgattaat ACATAT ctccaTCTTT 457 1.000000 2-1 552 cactatttta ACATGT ggaattcttg 557 1.000000 3-1 190 gccgcactca ACTTGT aactggcaac 195 1.000000 4-1 542 ccgctttgta ATATAT atttataccc 547 1.000000 5-1 307 tgaatgtctt ACATAT tgcaatggat 312 1.000000 6-1 686 taatgtgtag CTATGT tcagttagtt 691 1.000000 7-1 683 catttccaca ACATAT aagtaagatt 688 1.000000 8-1 219 ttaccaccat ATACAT atccatatct 224 1.000000 9-1 697 tcatttcact CCAAGT attttttaac 702 1.000000 10-1 76 TTTATagttc ATACAT gcttcaacta 81 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 452 457 454 -w 1.000000 >2 552 557 554 -w 1.000000 >3 190 195 192 -w 1.000000 >4 542 547 544 -w 1.000000 >5 307 312 309 -w 1.000000 >6 686 691 688 -w 1.000000 >7 683 688 685 -w 1.000000 >8 219 224 221 -w 1.000000 >9 697 702 699 -w 1.000000 >10 76 81 78 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.8 2 . 56 . 39 0.8 3 85 . . . 1.0 4 . . . 66 0.5 5 57 . 38 . 0.8 6 . . . 94 1.3 non- site 30 . . 31 site 40 . . 36 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 8 2 . 8 . 1 8 3 12 . . . 10 4 . . . 7 5 5 5 . 4 . 8 6 . . . 15 13 site 2 . . 1 1 Weighted motif model: POS A C G T Prob 1 0.755080 0.199943 0.016568 0.028409 0.829612 2 0.027807 0.563580 0.016568 0.392045 0.819633 3 0.845989 0.018125 0.016568 0.119318 0.955898 4 0.118716 0.199943 0.016568 0.664773 0.505347 5 0.573261 0.018125 0.380205 0.028409 0.761880 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 5.142057 Conservedness in prob: 8.005342 Concensus sequence: ACATGT Complete log-likelihood ratio = 68 bits Missing position information = 55 bits Log-likelihood ratio statistic = 12 bits Degrees of freedom = 18 Information per parameter = 0.711 bits MOTIF I 1-1 612 atatcatgcc ATTTTTCT ttcctttctc 619 1.000000 2-1 696 gtgaggcaac ACCTTTGT taccacattg 703 1.000000 3-1 648 agataggata AGTTTTGT agacatatat 655 1.000000 4-1 693 aaagctcata ACTTTTTT ttttgaacct 700 1.000000 5-1 216 ccagttctac ATTTTTTT ttttTTGGAA 223 1.000000 6-1 552 gctcattaga TATATTTT ctgtcatttt 559 1.000000 7-1 642 aaagagaagg TTTTTTTA ggctaagata 649 1.000000 8-1 151 AATTTtcaaa AATTCTTA cttTTTTTTt 158 1.000000 9-1 395 ctcatcttat AATTTTGT ggaaaaattc 402 1.000000 10-1 63 gagtagtaac ACTTTTAT agttcATACA 70 1.000000 sites: * **** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 612 619 615 -w 1.000000 >2 696 703 699 -w 1.000000 >3 648 655 651 -w 1.000000 >4 693 700 696 -w 1.000000 >5 216 223 219 -w 1.000000 >6 552 559 555 -w 1.000000 >7 642 649 645 -w 1.000000 >8 151 158 154 -w 1.000000 >9 395 402 398 -w 1.000000 >10 63 70 66 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.7 3 . . . 85 1.0 4 . . . 85 0.9 5 . . . 85 1.0 6 . . . 94 1.3 8 . . . 76 0.7 non- site . . . 31 site . . . 78 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 7 3 . . . 12 10 4 . . . 12 9 5 . . . 12 10 6 . . . 15 13 8 . . . 10 7 site . . . 10 8 Weighted motif model: POS A C G T Prob 1 0.755080 0.018125 0.016568 0.210227 0.744138 3 0.027807 0.109034 0.016568 0.846591 0.968787 4 0.118716 0.018125 0.016568 0.846591 0.935119 5 0.027807 0.109034 0.016568 0.846591 0.968787 6 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.209625 0.018125 0.016568 0.755682 0.728388 Conservedness in bits: 5.614907 Conservedness in prob: 8.475998 Concensus sequence: ATTTTT Complete log-likelihood ratio = 74 bits Missing position information = 53 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.12 bits MOTIF J 1-1 326 gttaaccaaa TCTTGATGTCT gttaacttct 336 1.000000 2-1 442 acaatctata TGTTGATAATT agcgttgcct 452 1.000000 3-1 269 tcaacgtcaa TTCGGAAAGCT TCCTTCcgga 279 1.000000 4-1 764 gcgtatacaa TCTCGATAGTT ggtttcccgt 774 1.000000 5-1 349 acttcctggc TTTAGATATTT gaaacttaac 359 1.000000 6-1 287 attgaaaatc TATGGAAAGAT atggacggta 297 1.000000 7-1 782 AAGTAagaat TTTTGAAAATT CAATATaa 792 1.000000 8-1 251 acttatatgt TGTGGAAATGT aaagagcccc 261 1.000000 9-1 716 ttttaacgta TATTGAAAGTT ctcaatagcg 726 1.000000 10-1 340 gagattgccg TCTTGAAACTT tttgtccttt 350 1.000000 sites: * * ** * * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 326 336 331 -w 1.000000 >2 442 452 447 -w 1.000000 >3 269 279 274 -w 1.000000 >4 764 774 769 -w 1.000000 >5 349 359 354 -w 1.000000 >6 287 297 292 -w 1.000000 >7 782 792 787 -w 1.000000 >8 251 261 256 -w 1.000000 >9 716 726 721 -w 1.000000 >10 340 350 345 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 3 . . . 85 1.0 5 . . 93 . 1.9 6 94 . . . 1.3 8 85 . . . 1.0 11 . . . 94 1.3 non- site . . . 31 site . . . 48 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 3 . . . 12 10 5 . . 22 . 19 6 15 . . . 13 8 12 . . . 10 11 . . . 15 13 site . . . 3 3 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.109034 0.016568 0.846591 0.968787 5 0.027807 0.018125 0.925659 0.028409 1.913088 6 0.936898 0.018125 0.016568 0.028409 1.294744 8 0.845989 0.018125 0.107477 0.028409 0.998787 11 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.714782 Conservedness in prob: 10.034941 Concensus sequence: TTGAAT Complete log-likelihood ratio = 101 bits Missing position information = 76 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.36 bits seed 4 time: 6 seconds (0.10 minutes) MOTIF A 1-1 507 taagtagtaa AAGTATTAT gcaTAGTTTT 515 1.000000 2-1 263 ttcgctgtaa AAACTTTAT cacacttatc 271 1.000000 3-1 786 taatAAAAAA AATAATTCT ttcata 794 1.000000 4-1 595 GTTTAattct AATATTAAT aatatcctAT 603 1.000000 5-1 380 tcttgtcaac AAACTTCCT atggagtgta 388 1.000000 6-1 732 GCAGGTcgga AATATTTAT gggcattatt 740 1.000000 7-1 455 agtattgtag AATCTTTAT tgttcggagc 463 1.000000 8-1 245 aaTCTTACTT ATATGTTGT ggaaatgtaa 253 1.000000 9-1 594 ctttcttctc AAACTTTGT aatgcgcctg 602 1.000000 10-1 99 ctacttaata AATGATTGT atgataatgt 107 1.000000 sites: ** *** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 507 515 511 -w 1.000000 >2 263 271 267 -w 1.000000 >3 786 794 790 -w 1.000000 >4 595 603 599 -w 1.000000 >5 380 388 384 -w 1.000000 >6 732 740 736 -w 1.000000 >7 455 463 459 -w 1.000000 >8 245 253 249 -w 1.000000 >9 594 602 598 -w 1.000000 >10 99 107 103 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 85 . . . 1.0 5 . . . 57 0.4 6 . . . 94 1.3 7 . . . 76 0.6 9 . . . 94 1.3 non- site 30 . . 31 site 38 . . 58 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 12 . . . 10 5 . . . 5 4 6 . . . 15 13 7 . . . 10 6 9 . . . 15 13 site 1 . . 5 5 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.845989 0.018125 0.016568 0.119318 0.955898 5 0.300534 0.018125 0.107477 0.573864 0.350968 6 0.027807 0.018125 0.016568 0.937500 1.269688 7 0.118716 0.109034 0.016568 0.755682 0.648329 9 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 5.789315 Conservedness in prob: 8.403345 Concensus sequence: AATTTT Complete log-likelihood ratio = 76 bits Missing position information = 55 bits Log-likelihood ratio statistic = 21 bits Degrees of freedom = 18 Information per parameter = 1.17 bits MOTIF B 1-1 376 gaactggcaa AATGTTGGTTC cttggttgtt 386 1.000000 2-1 453 gttgataatt AGCGTTGCCTC atcaatgcga 463 1.000000 3-1 5 catt AATTTTGCTTC caagacgaca 15 1.000000 4-1 161 tagtgcccaa TTGGGTGCCTC tatgatgggt 171 1.000000 5-1 740 tgagagctta ATAGGTGCATC ttagcaagct 750 1.000000 6-1 128 cttttagttc TTAATTGCAAC acatagattt 138 1.000000 7-1 749 attattaaac TTCTTTGCGTC catccaaaAA 759 1.000000 8-1 439 cctgaaacgc AGATGTGCCTC gcgccgcact 449 1.000000 9-1 527 cccacatttt ATTGCTGCCTC aatctccatt 537 1.000000 10-1 76 tttatagttc ATACATGCTTC aactacttaa 86 1.000000 sites: * *** ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 376 386 381 -w 1.000000 >2 453 463 458 -w 1.000000 >3 5 15 10 -w 1.000000 >4 161 171 166 -w 1.000000 >5 740 750 745 -w 1.000000 >6 128 138 133 -w 1.000000 >7 749 759 754 -w 1.000000 >8 439 449 444 -w 1.000000 >9 527 537 532 -w 1.000000 >10 76 86 81 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 66 . . . 0.6 6 . . . 94 1.3 7 . . 93 . 1.9 8 . 84 . . 1.5 10 . . . 85 0.9 11 . 93 . . 1.8 non- site . 19 . 31 site . 31 . 36 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 7 . . . 6 6 . . . 15 13 7 . . 22 . 19 8 . 17 . . 15 10 . . . 12 9 11 . 21 . . 18 site . 2 . 1 1 Weighted motif model: POS A C G T Prob 1 0.664170 0.018125 0.016568 0.301136 0.606837 6 0.027807 0.018125 0.016568 0.937500 1.269688 7 0.027807 0.018125 0.925659 0.028409 1.913088 8 0.027807 0.836307 0.107477 0.028409 1.453580 10 0.118716 0.018125 0.016568 0.846591 0.935119 11 0.027807 0.927216 0.016568 0.028409 1.804236 Conservedness in bits: 7.982549 Conservedness in prob: 10.771913 Concensus sequence: ATGCTC Complete log-likelihood ratio = 103 bits Missing position information = 79 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.37 bits MOTIF C 1-1 348 ttaacttctt TGTTTCTT tgttgaagaa 355 1.000000 2-1 12 tgctaaatca TTTGGCTT tttgattgat 19 1.000000 3-1 366 cgaaaggggc GGTTGCCT caggaaggca 373 1.000000 4-1 71 gtcttttggg TTTGTCTT caatacggca 78 1.000000 5-1 221 tctacatttt TTTTTTTT tggaagtatg 228 1.000000 6-1 788 aacagttgaa TATTCCCT caaaa 795 1.000000 7-1 418 ttactgccaa TTTTTCCT cttcataacc 425 1.000000 8-1 237 ccatatctaa TCTTACTT ATATGTTGTg 244 1.000000 9-1 303 attccgaaat TATTCCCT AGAACAagcg 310 1.000000 10-1 671 ctctgttctc TCTTACTT atatgatgat 678 1.000000 sites: * ** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 348 355 351 -w 1.000000 >2 12 19 15 -w 1.000000 >3 366 373 369 -w 1.000000 >4 71 78 74 -w 1.000000 >5 221 228 224 -w 1.000000 >6 788 795 791 -w 1.000000 >7 418 425 421 -w 1.000000 >8 237 244 240 -w 1.000000 >9 303 310 306 -w 1.000000 >10 671 678 674 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 1.0 3 . . . 94 1.3 4 . . . 76 0.8 6 . 84 . . 1.4 7 . 38 . 57 0.7 8 . . . 94 1.3 non- site . . . 31 site . . . 73 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 10 3 . . . 15 13 4 . . . 10 8 6 . 17 . . 14 7 . 4 . 5 7 8 . . . 15 13 site . . . 9 8 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.107477 0.846591 0.976452 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.198386 0.755682 0.828064 6 0.027807 0.836307 0.016568 0.119318 1.410690 7 0.027807 0.381761 0.016568 0.573864 0.707463 8 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.462045 Conservedness in prob: 8.887391 Concensus sequence: TTTCCT Complete log-likelihood ratio = 85 bits Missing position information = 60 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.38 bits MOTIF D 1-1 129 aagttttgat CAAGCA agttccaaga 134 1.000000 2-1 494 accggaccct AGTGCA cttaccccac 499 1.000000 3-1 522 ctcaagatgg GGAGCA aatggcatta 527 1.000000 4-1 328 atagagagaa GGAGCA agcaactgac 333 1.000000 5-1 433 gcgaacaatc GGGGCA gactattccg 438 1.000000 6-1 609 aaaaagcgct CGGACA actgttgacc 614 1.000000 7-1 43 taattatgct CGGGCA cttttcggcc 48 1.000000 8-1 464 cgcactgctc CGAACA ataaagattc 469 1.000000 9-1 311 atTATTCCCT AGAACA agcgggaaaa 316 1.000000 10-1 249 tattgtacgt GGGGCA gttgacgtct 254 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 129 134 131 -w 1.000000 >2 494 499 496 -w 1.000000 >3 522 527 524 -w 1.000000 >4 328 333 330 -w 1.000000 >5 433 438 435 -w 1.000000 >6 609 614 611 -w 1.000000 >7 43 48 45 -w 1.000000 >8 464 469 466 -w 1.000000 >9 311 316 313 -w 1.000000 >10 249 254 251 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 38 38 . 0.5 2 . . 83 . 1.5 3 48 . 38 . 0.5 4 . . 65 . 1.0 5 . 93 . . 1.8 6 94 . . . 1.3 non- site 30 19 18 . site 35 23 40 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 4 4 . 5 2 . . 18 . 15 3 3 . 4 . 5 4 . . 12 . 10 5 . 21 . . 18 6 15 . . . 13 site 1 1 5 . 5 Weighted motif model: POS A C G T Prob 1 0.209625 0.381761 0.380205 0.028409 0.548572 2 0.118716 0.018125 0.834750 0.028409 1.509552 3 0.482352 0.018125 0.380205 0.119318 0.491878 4 0.300534 0.018125 0.652932 0.028409 1.033437 5 0.027807 0.927216 0.016568 0.028409 1.804236 6 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.682419 Conservedness in prob: 9.990523 Concensus sequence: GGGGCA Complete log-likelihood ratio = 86 bits Missing position information = 53 bits Log-likelihood ratio statistic = 32 bits Degrees of freedom = 18 Information per parameter = 1.83 bits MOTIF E 1-1 554 ccggaatata TCTTTT cgggaagctc 559 1.000000 2-1 603 catcacacgg TCTTTT atgcaattga 608 1.000000 3-1 318 aatTTCTTTT TCTATT agtagctaaa 323 1.000000 4-1 621 tATATTTtct TCATTT accggcgcac 626 1.000000 5-1 242 aagtatgacc TCTGTT aaaTTTTTTT 247 1.000000 6-1 692 gtagctatgt TCAGTT agtttggcta 697 1.000000 7-1 280 catttatata TCTGTT aatagatcaa 285 1.000000 8-1 490 tacaatacta GCTTTT atggttatga 495 1.000000 9-1 149 tggacttttc TCTATT gtaaagcgga 154 1.000000 10-1 356 AACTTTTtgt CCTTTT ttttttccgg 361 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 554 559 556 -w 1.000000 >2 603 608 605 -w 1.000000 >3 318 323 320 -w 1.000000 >4 621 626 623 -w 1.000000 >5 242 247 244 -w 1.000000 >6 692 697 694 -w 1.000000 >7 280 285 282 -w 1.000000 >8 490 495 492 -w 1.000000 >9 149 154 151 -w 1.000000 >10 356 361 358 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 76 0.7 2 . 93 . . 1.8 3 . . . 76 0.7 4 . . 29 48 0.3 5 . . . 94 1.3 6 . . . 94 1.3 non- site . . . 31 site . . . 68 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 10 7 2 . 21 . . 18 3 . . . 10 7 4 . . 2 3 3 5 . . . 15 13 6 . . . 15 13 site . . . 8 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.109034 0.107477 0.755682 0.689662 2 0.027807 0.927216 0.016568 0.028409 1.804236 3 0.209625 0.018125 0.016568 0.755682 0.728388 4 0.209625 0.018125 0.289295 0.482955 0.319187 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.080849 Conservedness in prob: 8.601816 Concensus sequence: TCTGTT Complete log-likelihood ratio = 79 bits Missing position information = 61 bits Log-likelihood ratio statistic = 18 bits Degrees of freedom = 18 Information per parameter = 1.01 bits MOTIF F 1-1 323 ttggttaacc AAATCT tgatgtctgt 328 1.000000 2-1 406 cgtcaagtaa AGATTT cgtgttcatg 411 1.000000 3-1 75 cacatctatt ACATTT actgagcata 80 1.000000 4-1 612 ATaatatcct ATATTT tctTCATTTa 617 1.000000 5-1 401 ggagtgtata AGAATT gtAAGTTATa 406 1.000000 6-1 178 gctatttttt AAATTT ggagttcagt 183 1.000000 7-1 121 cttctgaatg AGATTT agtcattaTA 126 1.000000 8-1 699 aatactttca ACATTT tcagtttgta 704 1.000000 9-1 378 actgccccac ACATTT cctcatctta 383 1.000000 10-1 430 tggacaattc AGATTT tagtagacaa 435 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 323 328 325 -w 1.000000 >2 406 411 408 -w 1.000000 >3 75 80 77 -w 1.000000 >4 612 617 614 -w 1.000000 >5 401 406 403 -w 1.000000 >6 178 183 180 -w 1.000000 >7 121 126 123 -w 1.000000 >8 699 704 701 -w 1.000000 >9 378 383 380 -w 1.000000 >10 430 435 432 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 . 29 38 . 0.3 3 94 . . . 1.3 4 . . . 85 0.9 5 . . . 85 1.0 6 . . . 94 1.3 non- site 30 . . 31 site 38 . . 48 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 . 2 4 . 3 3 15 . . . 13 4 . . . 12 9 5 . . . 12 10 6 . . . 15 13 site 1 . . 3 2 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.209625 0.290852 0.380205 0.119318 0.281788 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.118716 0.018125 0.016568 0.846591 0.935119 5 0.027807 0.109034 0.016568 0.846591 0.968787 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.044871 Conservedness in prob: 8.751336 Concensus sequence: AGATTT Complete log-likelihood ratio = 79 bits Missing position information = 50 bits Log-likelihood ratio statistic = 28 bits Degrees of freedom = 18 Information per parameter = 1.58 bits MOTIF G 1-1 82 gttaatcaag AAGTTGT ctaagaagta 88 1.000000 2-1 60 gcAGGGGGTt GACTTTT accatttcac 66 1.000000 3-1 751 agaatagtaa TAGTTAA gtaaacacaa 757 1.000000 4-1 770 acaatctcga TAGTTGG tttcccgttc 776 1.000000 5-1 409 taAGAATTgt AAGTTAT aacaccggcg 415 1.000000 6-1 245 aattgtttac AAGTTCT ctgtaccacc 251 1.000000 7-1 135 TTagtcatta TAGTTTT ttctccttga 141 1.000000 8-1 588 ataatgcgat TAGTTTT ttagccttat 594 1.000000 9-1 169 agcggaaaaa AAGTTAT caccccgccc 175 1.000000 10-1 289 gtcatttgcg AAGTTCT tggcaagttg 295 1.000000 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 82 88 85 -w 1.000000 >2 60 66 63 -w 1.000000 >3 751 757 754 -w 1.000000 >4 770 776 773 -w 1.000000 >5 409 415 412 -w 1.000000 >6 245 251 248 -w 1.000000 >7 135 141 138 -w 1.000000 >8 588 594 591 -w 1.000000 >9 169 175 172 -w 1.000000 >10 289 295 292 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 48 . . 39 0.3 2 94 . . . 1.3 3 . . 83 . 1.5 4 . . . 94 1.3 5 . . . 94 1.3 7 . . . 76 0.7 non- site . . . 31 site . . . 53 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 3 . . 1 3 2 15 . . . 13 3 . . 18 . 15 4 . . . 15 13 5 . . . 15 13 7 . . . 10 7 site . . . 4 3 Weighted motif model: POS A C G T Prob 1 0.482352 0.018125 0.107477 0.392045 0.300651 2 0.936898 0.018125 0.016568 0.028409 1.294744 3 0.027807 0.109034 0.834750 0.028409 1.543220 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.018125 0.016568 0.937500 1.269688 7 0.118716 0.018125 0.107477 0.755682 0.655994 Conservedness in bits: 6.333985 Conservedness in prob: 8.911367 Concensus sequence: AAGTTT Complete log-likelihood ratio = 82 bits Missing position information = 63 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.07 bits MOTIF H 1-1 643 gatgttttgt AGGAAA tcacttagaa 648 1.000000 2-1 35 ttgattgtac AGGAAA atatacatcg 40 1.000000 3-1 780 ttaacataat AAAAAA AATAATTCTt 785 1.000000 4-1 478 tcttcactat AAGAAA atcacacgag 483 1.000000 5-1 795 aaattaagat AGAAAA 800 1.000000 6-1 389 cgcttcagtg AAAAAA tcataaggaa 394 1.000000 7-1 768 TCcatccaaa AAAAAA gtaagaattt 773 1.000000 8-1 790 cgtcaaggag AAAAAA ctata 795 1.000000 9-1 549 atctccatta AGAAAA aaaatttata 554 1.000000 10-1 503 ataggaaaaa AAAAAA gctttcaccg 508 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 643 648 645 -w 1.000000 >2 35 40 37 -w 1.000000 >3 780 785 782 -w 1.000000 >4 478 483 480 -w 1.000000 >5 795 800 797 -w 1.000000 >6 389 394 391 -w 1.000000 >7 768 773 770 -w 1.000000 >8 790 795 792 -w 1.000000 >9 549 554 551 -w 1.000000 >10 503 508 505 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 57 . 38 . 0.8 3 66 . 29 . 0.8 4 94 . . . 1.3 5 94 . . . 1.3 6 94 . . . 1.3 non- site 30 . . . site 88 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 5 . 4 . 8 3 7 . 2 . 8 4 15 . . . 13 5 15 . . . 13 6 15 . . . 13 site 14 . . . 13 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.573261 0.018125 0.380205 0.028409 0.761880 3 0.664170 0.018125 0.289295 0.028409 0.774819 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.715676 Conservedness in prob: 8.639266 Concensus sequence: AGAAAA Complete log-likelihood ratio = 89 bits Missing position information = 59 bits Log-likelihood ratio statistic = 30 bits Degrees of freedom = 18 Information per parameter = 1.68 bits MOTIF I 1-1 519 GTATTATgca TAGTTTT agccagatat 525 1.000000 2-1 646 ataggcagta AAATTTT tactgaaacg 652 1.000000 3-1 311 AGGTtgcaat TTCTTTT TCTATTagta 317 1.000000 4-1 583 tgcaatataa TAGTTTA attctAATAT 589 1.000000 5-1 251 cTCTGTTaaa TTTTTTT ttttttaaat 257 1.000000 6-1 452 gtagaggggg TAATTTT tcccctttat 458 1.000000 7-1 178 tatattaaca ATTTTTT gttgatactt 184 1.000000 8-1 772 tatacctcta TACTTTA acgtcaagga 778 1.000000 9-1 501 caagtgcctt TTTTTTT ttttttcatc 507 1.000000 10-1 346 gccgtcttga AACTTTT tgtCCTTTTt 352 1.000000 sites: ** **** 5 (10 sites in 10 sequences) Conservedness in sites: >1 519 525 522 -w 1.000000 >2 646 652 649 -w 1.000000 >3 311 317 314 -w 1.000000 >4 583 589 586 -w 1.000000 >5 251 257 254 -w 1.000000 >6 452 458 455 -w 1.000000 >7 178 184 181 -w 1.000000 >8 772 778 775 -w 1.000000 >9 501 507 504 -w 1.000000 >10 346 352 349 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 66 0.6 2 57 . . 39 0.5 4 . . . 94 1.3 5 . . . 94 1.3 6 . . . 94 1.3 7 . . . 76 0.7 non- site . . . 31 site . . . 81 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 7 6 2 5 . . 1 5 4 . . . 15 13 5 . . . 15 13 6 . . . 15 13 7 . . . 10 7 site . . . 11 10 Weighted motif model: POS A C G T Prob 1 0.300534 0.018125 0.016568 0.664773 0.596285 2 0.573261 0.018125 0.016568 0.392045 0.527763 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.018125 0.016568 0.937500 1.269688 7 0.209625 0.018125 0.016568 0.755682 0.728388 Conservedness in bits: 5.661500 Conservedness in prob: 8.024066 Concensus sequence: TATTTT Complete log-likelihood ratio = 75 bits Missing position information = 53 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.23 bits MOTIF J 1-1 257 ttccaattga AGAAGGT cttgtgtttg 263 1.000000 2-1 52 tatacatcgc AGGGGGT tGACTTTTac 58 1.000000 3-1 298 gaatggctta AGTAGGT tgcaatTTCT 304 1.000000 4-1 394 gtgcaagcat AGTGGGG ccttcttcca 400 1.000000 5-1 90 gcaactactc AATAGGT aacatgagaa 96 1.000000 6-1 721 aagatataaa AGCAGGT cggaAATATT 727 1.000000 7-1 532 cgaggacgca CGGAGGA gagtcttccg 538 1.000000 8-1 50 tagctctacc ACAGTGT gtgaaccaat 56 1.000000 9-1 330 gggaaaaagg TCCGGGG aaatggagtc 336 1.000000 10-1 451 gacaagcgcg AGGAGGA aaagaaatga 457 1.000000 sites: ** **** 5 (10 sites in 10 sequences) Conservedness in sites: >1 257 263 260 -w 1.000000 >2 52 58 55 -w 1.000000 >3 298 304 301 -w 1.000000 >4 394 400 397 -w 1.000000 >5 90 96 93 -w 1.000000 >6 721 727 724 -w 1.000000 >7 532 538 535 -w 1.000000 >8 50 56 53 -w 1.000000 >9 330 336 333 -w 1.000000 >10 451 457 454 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.7 2 . . 65 . 0.9 4 57 . 38 . 0.8 5 . . 83 . 1.5 6 . . 93 . 1.9 7 . . . 57 0.4 non- site . . 18 . site . . 53 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 7 2 . . 12 . 9 4 5 . 4 . 8 5 . . 18 . 15 6 . . 22 . 19 7 . . . 5 4 site . . 8 . 5 Weighted motif model: POS A C G T Prob 1 0.755080 0.109034 0.016568 0.119318 0.666396 2 0.118716 0.199943 0.652932 0.028409 0.942500 4 0.573261 0.018125 0.380205 0.028409 0.761880 5 0.027807 0.018125 0.834750 0.119318 1.507995 6 0.027807 0.018125 0.925659 0.028409 1.913088 7 0.209625 0.018125 0.198386 0.573864 0.350499 Conservedness in bits: 6.142358 Conservedness in prob: 9.622396 Concensus sequence: AGGGGT Complete log-likelihood ratio = 79 bits Missing position information = 68 bits Log-likelihood ratio statistic = 10 bits Degrees of freedom = 18 Information per parameter = 0.595 bits seed 5 time: 6 seconds (0.10 minutes) MOTIF A 1-1 50 GATGACTTga AGAAGT tgaacaagaa 55 1.000000 2-1 769 aaaaagagaa AATAAA agtaaaaagg 774 1.000000 3-1 746 catcaagaat AGTAAT agttaagtaa 751 1.000000 4-1 673 tgctacattc ATAATA accaaaagct 678 1.000000 5-1 398 tatggagtgt ATAAGA attgtaagtt 403 1.000000 6-1 773 aacatgataa AAAAAA acagttgaat 778 1.000000 7-1 158 ttgacgttaa AGTATA gaggtatatT 163 1.000000 8-1 788 aacgtcaagg AGAAAA aactata 793 1.000000 9-1 549 atctccatta AGAAAA aaaatttata 554 1.000000 10-1 469 AAGAAATgac AGAAAA attccgatgg 474 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 50 55 52 -w 1.000000 >2 769 774 771 -w 1.000000 >3 746 751 748 -w 1.000000 >4 673 678 675 -w 1.000000 >5 398 403 400 -w 1.000000 >6 773 778 775 -w 1.000000 >7 158 163 160 -w 1.000000 >8 788 793 790 -w 1.000000 >9 549 554 551 -w 1.000000 >10 469 474 471 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 . . 56 . 0.6 3 66 . . . 0.6 4 94 . . . 1.3 5 57 . . . 0.4 6 76 . . . 0.7 non- site 30 . . . site 71 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 . . 9 . 6 3 7 . . . 6 4 15 . . . 13 5 5 . . . 4 6 10 . . . 7 site 9 . . . 7 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.209625 0.018125 0.562023 0.210227 0.615918 3 0.664170 0.018125 0.016568 0.301136 0.606837 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.573261 0.018125 0.198386 0.210227 0.360867 6 0.755080 0.018125 0.016568 0.210227 0.744138 Conservedness in bits: 4.917250 Conservedness in prob: 8.183157 Concensus sequence: AGAAAA Complete log-likelihood ratio = 65 bits Missing position information = 49 bits Log-likelihood ratio statistic = 15 bits Degrees of freedom = 18 Information per parameter = 0.864 bits MOTIF B 1-1 680 ttaaaagcat GTTGAGTG aatttcacag 687 1.000000 2-1 586 AAATcgccat GCCAAGCC atcacacggt 593 1.000000 3-1 520 atctcaagat GGGGAGCA aatggcatta 527 1.000000 4-1 749 ggtccttgcc GACCAGCG tatacaatct 756 1.000000 5-1 728 cttgattcag GATGAGAG cttaataggt 735 1.000000 6-1 531 tcggagcact GTTGAGCG aaggctcatt 538 1.000000 7-1 608 gcaatgagca GTTAAGCG tattactgaa 615 1.000000 8-1 361 attagaagcc GCCGAGCG ggcgacagCC 368 1.000000 9-1 155 TTTCTCTATt GTAAAGCG GAAAAAAAGT 162 1.000000 10-1 441 gattttagta GACAAGCG cgagGAGGAA 448 1.000000 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 680 687 683 -w 1.000000 >2 586 593 589 -w 1.000000 >3 520 527 523 -w 1.000000 >4 749 756 752 -w 1.000000 >5 728 735 731 -w 1.000000 >6 531 538 534 -w 1.000000 >7 608 615 611 -w 1.000000 >8 361 368 364 -w 1.000000 >9 155 162 158 -w 1.000000 >10 441 448 444 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 93 . 1.9 4 39 . 47 . 0.6 5 94 . . . 1.3 6 . . 93 . 1.9 7 . 75 . . 1.0 8 . . 74 . 1.2 non- site . . 18 . site . . 55 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 22 . 19 4 1 . 6 . 6 5 15 . . . 13 6 . . 22 . 19 7 . 14 . . 10 8 . . 15 . 12 site . . 9 . 7 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.925659 0.028409 1.913088 4 0.391443 0.109034 0.471114 0.028409 0.591583 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.027807 0.018125 0.925659 0.028409 1.913088 7 0.118716 0.745398 0.016568 0.119318 1.032986 8 0.118716 0.109034 0.743841 0.028409 1.153995 Conservedness in bits: 7.899484 Conservedness in prob: 11.605831 Concensus sequence: GGAGCG Complete log-likelihood ratio = 101 bits Missing position information = 74 bits Log-likelihood ratio statistic = 27 bits Degrees of freedom = 18 Information per parameter = 1.5 bits MOTIF C 1-1 416 atgggtccag CTTTCAGATTG tactaatcac 426 1.000000 2-1 17 aatcatttgg CTTTTTGATTG attgtacAGG 27 1.000000 3-1 392 caccggcggt CTTTCGTCCGT gcggagatat 402 1.000000 4-1 558 atttataccc CTTTCTTCTCT cccctgcaat 568 1.000000 5-1 272 ttaaatttca CTTTCTAAAGT cccagaaatc 282 1.000000 6-1 556 attagatata TTTTCTGTCAT tttccttaac 566 1.000000 7-1 264 ggttatgcag CTTTTCCATTT atatatctgt 274 1.000000 8-1 107 tttagaagta CTTTCACTTTG taactgagct 117 1.000000 9-1 143 cttacttgga CTTTTCTCTAT tGTAAAGCGG 153 1.000000 10-1 753 tagagaagat CTTTCGGTTCG aagacattcc 763 1.000000 sites: ***** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 416 426 421 -w 1.000000 >2 17 27 22 -w 1.000000 >3 392 402 397 -w 1.000000 >4 558 568 563 -w 1.000000 >5 272 282 277 -w 1.000000 >6 556 566 561 -w 1.000000 >7 264 274 269 -w 1.000000 >8 107 117 112 -w 1.000000 >9 143 153 148 -w 1.000000 >10 753 763 758 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.4 2 . . . 94 1.3 3 . . . 94 1.3 4 . . . 94 1.3 5 . 65 . . 1.0 11 . . 38 57 0.7 non- site . 19 . 31 site . 26 . 66 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 14 2 . . . 15 13 3 . . . 15 13 4 . . . 15 13 5 . 11 . . 10 11 . . 4 5 7 site . 1 . 7 7 Weighted motif model: POS A C G T Prob 1 0.027807 0.836307 0.016568 0.119318 1.410690 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.654489 0.016568 0.301136 0.952767 11 0.027807 0.018125 0.380205 0.573864 0.747638 Conservedness in bits: 6.920159 Conservedness in prob: 9.599176 Concensus sequence: CTTTCG Complete log-likelihood ratio = 91 bits Missing position information = 65 bits Log-likelihood ratio statistic = 25 bits Degrees of freedom = 18 Information per parameter = 1.44 bits MOTIF D 1-1 643 gatgttttgt AGGAAA tcacttagaa 648 1.000000 2-1 35 TTGattgtac AGGAAA atatacatcg 40 1.000000 3-1 375 cggttgcctc AGGAAG gcaccggcgg 380 1.000000 4-1 369 actggacctg AAGACA tgcaACAAAG 374 1.000000 5-1 645 ccgagctttc AGGAAA agactacggc 650 1.000000 6-1 586 cccaaaaata AGGGAA agggtccaaa 591 1.000000 7-1 524 ggtgaagacg AGGACG cacggaggag 529 1.000000 8-1 508 ggttatgaag AGGAAA aattggcagt 513 1.000000 9-1 664 taataactta AGGAAA catacaaaaa 669 1.000000 10-1 495 acaagaagat AGGAAA aaaaaaaagc 500 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 643 648 645 -w 1.000000 >2 35 40 37 -w 1.000000 >3 375 380 377 -w 1.000000 >4 369 374 371 -w 1.000000 >5 645 650 647 -w 1.000000 >6 586 591 588 -w 1.000000 >7 524 529 526 -w 1.000000 >8 508 513 510 -w 1.000000 >9 664 669 666 -w 1.000000 >10 495 500 497 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 . . 83 . 1.5 3 . . 93 . 1.9 4 85 . . . 1.0 5 76 . . . 0.8 6 76 . . . 0.8 non- site 30 . 18 . site 60 . 36 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 . . 18 . 15 3 . . 22 . 19 4 12 . . . 10 5 10 . . . 8 6 10 . . . 8 site 6 . 4 . 9 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.118716 0.018125 0.834750 0.028409 1.509552 3 0.027807 0.018125 0.925659 0.028409 1.913088 4 0.845989 0.018125 0.107477 0.028409 0.998787 5 0.755080 0.199943 0.016568 0.028409 0.829612 6 0.755080 0.018125 0.198386 0.028409 0.847687 Conservedness in bits: 7.393470 Conservedness in prob: 10.230006 Concensus sequence: AGGAAA Complete log-likelihood ratio = 96 bits Missing position information = 67 bits Log-likelihood ratio statistic = 28 bits Degrees of freedom = 18 Information per parameter = 1.6 bits MOTIF E 1-1 530 agttttagcc AGATATTTTTG ggcccggaat 540 1.000000 2-1 214 catacctctc TCCGTATCCTC gtaatcattt 224 1.000000 3-1 646 ggagatagga TAAGTTTTGTA gacatatata 656 1.000000 4-1 48 Tcagagatgg TGCTTATCCTC atgtcttttg 58 1.000000 5-1 6 gtctt AGTATCTCATC tcatctcaat 16 1.000000 6-1 450 aagtagaggg GGTAATTTTTC ccctttattt 460 1.000000 7-1 173 Agaggtatat TAACAATTTTT tgttgatact 183 1.000000 8-1 389 CTCCGAcgga AGACTCTCCTC cgtgcgtcct 399 1.000000 9-1 503 agtgcctttt TTTTTTTTTTT catcccacat 513 1.000000 10-1 355 aaactttttg TCCTTTTTTTT ttccggggaC 365 1.000000 sites: * * ** ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 530 540 535 -w 1.000000 >2 214 224 219 -w 1.000000 >3 646 656 651 -w 1.000000 >4 48 58 53 -w 1.000000 >5 6 16 11 -w 1.000000 >6 450 460 455 -w 1.000000 >7 173 183 178 -w 1.000000 >8 389 399 394 -w 1.000000 >9 503 513 508 -w 1.000000 >10 355 365 360 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 57 0.4 5 . . . 66 0.6 7 . . . 94 1.3 8 . 38 . 57 0.7 10 . . . 94 1.3 11 . 47 . . 0.3 non- site . . . 31 site . . . 70 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 5 4 5 . . . 7 6 7 . . . 15 13 8 . 4 . 5 7 10 . . . 15 13 11 . 6 . . 3 site . . . 8 5 Weighted motif model: POS A C G T Prob 1 0.300534 0.018125 0.107477 0.573864 0.350968 5 0.300534 0.018125 0.016568 0.664773 0.596285 7 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.027807 0.381761 0.016568 0.573864 0.707463 10 0.027807 0.018125 0.016568 0.937500 1.269688 11 0.118716 0.472670 0.107477 0.301136 0.328564 Conservedness in bits: 4.522655 Conservedness in prob: 7.318319 Concensus sequence: TTTCTC Complete log-likelihood ratio = 60 bits Missing position information = 46 bits Log-likelihood ratio statistic = 14 bits Degrees of freedom = 18 Information per parameter = 0.783 bits MOTIF F 1-1 35 gacgctatgt CCGTCGATGACTT gaAGAAGTtg 47 1.000000 2-1 567 tggaattctt GAAAGAATGAAAT cgccatGCCA 579 1.000000 3-1 686 taattggatt GAAAATTTGGTGT tgtgaattgc 698 1.000000 4-1 26 gacttggtgc TCGAAGATGCTTT cagagatggT 38 1.000000 5-1 188 tagagtgaat GAGCTGATGATAT ttcgcccagt 200 1.000000 6-1 99 tatccttctt GAAAATATGCACT ctatatcttt 111 1.000000 7-1 718 tatgtatatg GTGGTAATGCCAT gtaatatgat 730 1.000000 8-1 174 tttttggatg GACGCAAAGAAGT TTAATAAtca 186 1.000000 9-1 163 TtGTAAAGCG GAAAAAAAGTTAT caccccgccc 175 1.000000 10-1 453 CAAGCGcgag GAGGAAAAGAAAT gacAGAAAAa 465 1.000000 sites: * * *** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 35 47 41 -w 1.000000 >2 567 579 573 -w 1.000000 >3 686 698 692 -w 1.000000 >4 26 38 32 -w 1.000000 >5 188 200 194 -w 1.000000 >6 99 111 105 -w 1.000000 >7 718 730 724 -w 1.000000 >8 174 186 180 -w 1.000000 >9 163 175 169 -w 1.000000 >10 453 465 459 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 74 . 1.2 3 39 . 47 . 0.6 7 85 . . . 1.0 8 . . . 66 0.6 9 . . 93 . 1.9 13 . . . 94 1.3 non- site . . 18 . site . . 38 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 15 . 12 3 1 . 6 . 6 7 12 . . . 10 8 . . . 7 6 9 . . 22 . 19 13 . . . 15 13 site . . 4 . 3 Weighted motif model: POS A C G T Prob 1 0.027807 0.109034 0.743841 0.119318 1.152439 3 0.391443 0.109034 0.471114 0.028409 0.591583 7 0.845989 0.018125 0.016568 0.119318 0.955898 8 0.300534 0.018125 0.016568 0.664773 0.596285 9 0.027807 0.018125 0.925659 0.028409 1.913088 13 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.478979 Conservedness in prob: 9.885457 Concensus sequence: GGATGT Complete log-likelihood ratio = 84 bits Missing position information = 69 bits Log-likelihood ratio statistic = 14 bits Degrees of freedom = 18 Information per parameter = 0.811 bits MOTIF G 1-1 754 tataatcttc GACTCGCA taatataggt 761 1.000000 2-1 112 agaatgttca CAGGCGCA taCGCTACAA 119 1.000000 3-1 469 aggcagtatc GGGGCGGA tCACTCCGAa 476 1.000000 4-1 437 tgccactgct GCTACGGA aaaccaacct 444 1.000000 5-1 593 cccgtgtgac GAATCGCA caccgctgct 600 1.000000 6-1 328 tatagcacga GCCGCGGA gttcatttcg 335 1.000000 7-1 464 gaatctttat TGTTCGGA gcagtgcggc 471 1.000000 8-1 432 tcgcgttcct GAAACGCA gatgtgcctc 439 1.000000 9-1 210 ccactaaaac GATCAGCA aatggcagaa 217 1.000000 10-1 574 tttcaagtta GACAAGGA caaaatcagg 581 1.000000 sites: ** **** 5 (10 sites in 10 sequences) Conservedness in sites: >1 754 761 757 -w 1.000000 >2 112 119 115 -w 1.000000 >3 469 476 472 -w 1.000000 >4 437 444 440 -w 1.000000 >5 593 600 596 -w 1.000000 >6 328 335 331 -w 1.000000 >7 464 471 467 -w 1.000000 >8 432 439 435 -w 1.000000 >9 210 217 213 -w 1.000000 >10 574 581 577 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 74 . 1.2 2 57 . . . 0.4 5 . 75 . . 1.1 6 . . 93 . 1.9 7 . 47 47 . 1.0 8 94 . . . 1.3 non- site . 19 18 . site . 26 41 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 15 . 12 2 5 . . . 4 5 . 14 . . 11 6 . . 22 . 19 7 . 6 6 . 10 8 15 . . . 13 site . 1 5 . 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.109034 0.743841 0.119318 1.152439 2 0.573261 0.199943 0.198386 0.028409 0.446341 5 0.209625 0.745398 0.016568 0.028409 1.148270 6 0.027807 0.018125 0.925659 0.028409 1.913088 7 0.027807 0.472670 0.471114 0.028409 1.039664 8 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.994547 Conservedness in prob: 10.167520 Concensus sequence: GACGGA Complete log-likelihood ratio = 91 bits Missing position information = 60 bits Log-likelihood ratio statistic = 30 bits Degrees of freedom = 18 Information per parameter = 1.69 bits MOTIF H 1-1 721 GGTGTtcaat CAGTTCAA ccatacctgc 728 1.000000 2-1 122 CAGGCGCAta CGCTACAA tgacccgatt 129 1.000000 3-1 478 cGGGGCGGAt CACTCCGA accgagatta 485 1.000000 4-1 311 cagatggaat CCCTTCCA tagagagaag 318 1.000000 5-1 243 agtatgacct CTGTTAAA tttttttttt 250 1.000000 6-1 605 gtccaaaaag CGCTCGGA CAACTGTtga 612 1.000000 7-1 673 gggctcttta CATTTCCA caacatataa 680 1.000000 8-1 377 CGggcgacag CCCTCCGA cggaAGACTC 384 1.000000 9-1 307 cgaaattatt CCCTAGAA caagcgggaa 314 1.000000 10-1 375 Tttccgggga CTCTACGA gaaccctttg 382 1.000000 sites: * ** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 721 728 724 -w 1.000000 >2 122 129 125 -w 1.000000 >3 478 485 481 -w 1.000000 >4 311 318 314 -w 1.000000 >5 243 250 246 -w 1.000000 >6 605 612 608 -w 1.000000 >7 673 680 676 -w 1.000000 >8 377 384 380 -w 1.000000 >9 307 314 310 -w 1.000000 >10 375 382 378 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 3 . 65 . . 0.9 4 . . . 94 1.3 6 . 65 . . 0.9 7 39 . 38 . 0.4 8 94 . . . 1.3 non- site . 19 . . site . 43 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 3 . 11 . . 9 4 . . . 15 13 6 . 11 . . 9 7 1 . 4 . 4 8 15 . . . 13 site . 5 . . 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 3 0.027807 0.654489 0.198386 0.119318 0.884719 4 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.118716 0.654489 0.198386 0.028409 0.886276 7 0.391443 0.199943 0.380205 0.028409 0.445183 8 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.584847 Conservedness in prob: 9.907957 Concensus sequence: CCTCGA Complete log-likelihood ratio = 85 bits Missing position information = 64 bits Log-likelihood ratio statistic = 21 bits Degrees of freedom = 18 Information per parameter = 1.21 bits MOTIF I 1-1 709 tcgatatgct TTGGTGT tcaatCAGTT 715 1.000000 2-1 305 ttaaccgctt TTACTAT tatcttctac 311 1.000000 3-1 79 tctattacat TTACTGA gcataacggg 85 1.000000 4-1 347 aactgaccca ATATTGA ctgccactgg 353 1.000000 5-1 711 tcaagacatt CTAATGA cttgattcag 717 1.000000 6-1 613 agCGCTCGGA CAACTGT tgaccgtgat 619 1.000000 7-1 408 tggggccagg TTACTGC caatttttcc 414 1.000000 8-1 187 GCAAAGAAGT TTAATAA tcatattaca 193 1.000000 9-1 74 ggtatgcgta TTAGTAA actattaggg 80 1.000000 10-1 307 ggcaagttgc CAACTGA cgagatgcag 313 1.000000 sites: *** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 709 715 712 -w 1.000000 >2 305 311 308 -w 1.000000 >3 79 85 82 -w 1.000000 >4 347 353 350 -w 1.000000 >5 711 717 714 -w 1.000000 >6 613 619 616 -w 1.000000 >7 408 414 411 -w 1.000000 >8 187 193 190 -w 1.000000 >9 74 80 77 -w 1.000000 >10 307 313 310 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 29 . 57 0.4 2 . . . 76 0.7 3 85 . . . 1.0 5 . . . 94 1.3 6 . . 65 . 1.0 7 57 . . . 0.4 non- site 30 . . 31 site 35 . . 45 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 2 . 5 4 2 . . . 10 7 3 12 . . . 10 5 . . . 15 13 6 . . 12 . 10 7 5 . . . 4 site 1 . . 2 1 Weighted motif model: POS A C G T Prob 1 0.118716 0.290852 0.016568 0.573864 0.442236 2 0.209625 0.018125 0.016568 0.755682 0.728388 3 0.845989 0.018125 0.107477 0.028409 0.998787 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.300534 0.018125 0.652932 0.028409 1.033437 7 0.573261 0.109034 0.016568 0.301136 0.351173 Conservedness in bits: 4.823709 Conservedness in prob: 7.950697 Concensus sequence: TTATGA Complete log-likelihood ratio = 63 bits Missing position information = 52 bits Log-likelihood ratio statistic = 10 bits Degrees of freedom = 18 Information per parameter = 0.595 bits MOTIF J 1-1 504 ctctaagtag TAAAAGT attatgcata 510 1.000000 2-1 356 cacatattaa ACACAGT ggtttctttg 362 1.000000 3-1 21 gcttccaaga CGACAGT aatatgtctc 27 1.000000 4-1 379 AAGACAtgca ACAAAGT gcaagcatag 385 1.000000 5-1 378 actcttgtca ACAAACT tcctatggag 384 1.000000 6-1 644 aggactggct ATACAGT gttcacaaaa 650 1.000000 7-1 769 ccatccaaaa AAAAAGT aagaattttt 775 1.000000 8-1 17 atcagcaaca ACACAGT catatccatt 23 1.000000 9-1 787 catagagtac ACACACT caaagga 793 1.000000 10-1 534 ctagaccgga AAAAAGT cgtatgacat 540 1.000000 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 504 510 507 -w 1.000000 >2 356 362 359 -w 1.000000 >3 21 27 24 -w 1.000000 >4 379 385 382 -w 1.000000 >5 378 384 381 -w 1.000000 >6 644 650 647 -w 1.000000 >7 769 775 772 -w 1.000000 >8 17 23 20 -w 1.000000 >9 787 793 790 -w 1.000000 >10 534 540 537 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.7 3 94 . . . 1.3 4 48 47 . . 0.8 5 94 . . . 1.3 6 . . 74 . 1.3 7 . . . 94 1.3 non- site 30 . . . site 55 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 7 3 15 . . . 13 4 3 6 . . 8 5 15 . . . 13 6 . . 15 . 13 7 . . . 15 13 site 5 . . . 2 Weighted motif model: POS A C G T Prob 1 0.755080 0.109034 0.016568 0.119318 0.666396 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.482352 0.472670 0.016568 0.028409 0.750020 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.027807 0.199943 0.743841 0.028409 1.315655 7 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.591247 Conservedness in prob: 9.392973 Concensus sequence: AACAGT Complete log-likelihood ratio = 86 bits Missing position information = 60 bits Log-likelihood ratio statistic = 26 bits Degrees of freedom = 18 Information per parameter = 1.47 bits seed 6 time: 6 seconds (0.10 minutes) MOTIF A 1-1 625 tttctttcct TTCTCAGC gatgttttgt 632 1.000000 2-1 150 cttgctagcc TTTTCTCG gtcttgcaaa 157 1.000000 3-1 392 caccggcggt CTTTCGTC cgtgcggaga 399 1.000000 4-1 786 gtttcccgtt CTTTCCAC tcccgtc 793 1.000000 5-1 149 tatttgggct CTTTGCTC gaggttacag 156 1.000000 6-1 456 aGGGGGTAAt TTTTCCCC tttattttgt 463 1.000000 7-1 140 cattatagtt TTTTCTCC ttgacgttaa 147 1.000000 8-1 693 ttaactaata CTTTCAAC attttcagtt 700 1.000000 9-1 584 gacatttttc CTTTCTTC tcaaactttg 591 1.000000 10-1 563 GAAtgaaaaa TTTTCAAG ttagacaagg 570 1.000000 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 625 632 628 -w 1.000000 >2 150 157 153 -w 1.000000 >3 392 399 395 -w 1.000000 >4 786 793 789 -w 1.000000 >5 149 156 152 -w 1.000000 >6 456 463 459 -w 1.000000 >7 140 147 143 -w 1.000000 >8 693 700 696 -w 1.000000 >9 584 591 587 -w 1.000000 >10 563 570 566 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 47 . 48 0.7 2 . . . 94 1.3 3 . . . 85 1.0 4 . . . 94 1.3 5 . 84 . . 1.5 8 . 75 . . 1.2 non- site . 19 . 31 site . 38 . 56 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 6 . 3 7 2 . . . 15 13 3 . . . 12 10 4 . . . 15 13 5 . 17 . . 15 8 . 14 . . 12 site . 4 . 5 8 Weighted motif model: POS A C G T Prob 1 0.027807 0.472670 0.016568 0.482955 0.738438 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.109034 0.016568 0.846591 0.968787 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.836307 0.107477 0.028409 1.453580 8 0.027807 0.745398 0.198386 0.028409 1.247945 Conservedness in bits: 6.948126 Conservedness in prob: 9.824158 Concensus sequence: CTTTCC Complete log-likelihood ratio = 91 bits Missing position information = 63 bits Log-likelihood ratio statistic = 27 bits Degrees of freedom = 18 Information per parameter = 1.55 bits MOTIF B 1-1 794 aatagattac TTGCAA a 799 1.000000 2-1 237 aatcattttc TTGTAT ttatcgtctt 242 1.000000 3-1 192 cgcactcaac TTGTAA ctggcaacta 197 1.000000 4-1 537 gttttccgct TTGTAA tatatattta 542 1.000000 5-1 544 agcacgcaga TTGCAA acacggctta 549 1.000000 6-1 408 TAAGGAaaag TTGTAA atattattgg 413 1.000000 7-1 449 aaagctagta TTGTAG aatctttatt 454 1.000000 8-1 115 tactttcact TTGTAA CTGAGCtgtc 120 1.000000 9-1 153 cttttctcta TTGTAA agcggaaaaa 158 1.000000 10-1 104 taataaatga TTGTAT gataatgttt 109 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 794 799 796 -w 1.000000 >2 237 242 239 -w 1.000000 >3 192 197 194 -w 1.000000 >4 537 542 539 -w 1.000000 >5 544 549 546 -w 1.000000 >6 408 413 410 -w 1.000000 >7 449 454 451 -w 1.000000 >8 115 120 117 -w 1.000000 >9 153 158 155 -w 1.000000 >10 104 109 106 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 3 . . 93 . 1.9 4 . . . 76 0.8 5 94 . . . 1.3 6 66 . . . 0.5 non- site . . . 31 site . . . 50 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 3 . . 22 . 19 4 . . . 10 8 5 15 . . . 13 6 7 . . . 5 site . . . 3 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.925659 0.028409 1.913088 4 0.027807 0.199943 0.016568 0.755682 0.809989 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.664170 0.018125 0.107477 0.210227 0.478131 Conservedness in bits: 7.035327 Conservedness in prob: 9.521971 Concensus sequence: TTGTAA Complete log-likelihood ratio = 92 bits Missing position information = 70 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.24 bits MOTIF C 1-1 62 aagttgaaca AGAACAAGAA gttaatcaag 71 1.000000 2-1 672 gtatataatc ATCATAAGCG acaagtgaGG 681 1.000000 3-1 159 acagcaatat AGGACTAGAA aatatcaggt 168 1.000000 4-1 138 aatgctttcc ATGACGATCA tcgtagtgcc 147 1.000000 5-1 35 atttctatat TCCACTATAA aatttttcac 44 1.000000 6-1 394 cagtgaaaaa ATCATAAGGA aaagTTGTAA 403 1.000000 7-1 7 cggttt AGCATCATAA gcgcttataa 16 1.000000 8-1 314 aactttcagt AATACGCTTA actgctcatt 323 1.000000 9-1 205 ctcctccact AAAACGATCA gcaaatggca 214 1.000000 10-1 48 atacgcaata ATAACGAGTA gtaacacttt 57 1.000000 sites: * ** ** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 62 71 66 -w 1.000000 >2 672 681 676 -w 1.000000 >3 159 168 163 -w 1.000000 >4 138 147 142 -w 1.000000 >5 35 44 39 -w 1.000000 >6 394 403 398 -w 1.000000 >7 7 16 11 -w 1.000000 >8 314 323 318 -w 1.000000 >9 205 214 209 -w 1.000000 >10 48 57 52 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 4 94 . . . 1.3 5 . 65 . . 1.0 7 85 . . . 1.0 8 . . 47 48 0.8 10 85 . . . 1.0 non- site 30 . . . site 61 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 4 15 . . . 13 5 . 11 . . 10 7 12 . . . 10 8 . . 6 3 8 10 12 . . . 10 site 6 . . . 3 Weighted motif model: POS A C G T Prob 1 0.845989 0.018125 0.016568 0.119318 0.955898 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.027807 0.654489 0.016568 0.301136 0.952767 7 0.845989 0.109034 0.016568 0.028409 0.991122 8 0.027807 0.018125 0.471114 0.482955 0.789912 10 0.845989 0.018125 0.107477 0.028409 0.998787 Conservedness in bits: 5.983230 Conservedness in prob: 9.103078 Concensus sequence: AACAGA Complete log-likelihood ratio = 78 bits Missing position information = 61 bits Log-likelihood ratio statistic = 17 bits Degrees of freedom = 18 Information per parameter = 0.997 bits MOTIF D 1-1 371 aagaagaact GGCAAAAT gttggttcct 378 1.000000 2-1 690 CGacaagtga GGCAACAC ctttgttacc 697 1.000000 3-1 460 taaggcagaa GGCAGTAT CGGGGCggat 467 1.000000 4-1 327 catagagaga AGGAGCAA gcaactgacc 334 1.000000 5-1 170 gttacagaag GGCCGCAT tagagtgaat 177 1.000000 6-1 447 gtaaagtaga GGGGGTAA tTTTTCCCCt 454 1.000000 7-1 333 ccagaaataa GGCTAAAA aactAATCGC 340 1.000000 8-1 508 ggttatgaag AGGAAAAA ttggcagtaa 515 1.000000 9-1 317 ccctagaaca AGCGGGAA aaaggtcCGG 324 1.000000 10-1 451 gacaagcgcg AGGAGGAA aagaaatgac 458 1.000000 sites: *** * ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 371 378 374 -w 1.000000 >2 690 697 693 -w 1.000000 >3 460 467 463 -w 1.000000 >4 327 334 330 -w 1.000000 >5 170 177 173 -w 1.000000 >6 447 454 450 -w 1.000000 >7 333 340 336 -w 1.000000 >8 508 515 511 -w 1.000000 >9 317 324 320 -w 1.000000 >10 451 458 454 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 39 . 56 . 0.9 2 . . 93 . 1.9 3 . 56 38 . 1.1 5 39 . 56 . 0.9 7 94 . . . 1.3 8 57 . . . 0.4 non- site 30 . 18 . site 40 . 43 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 1 . 9 . 9 2 . . 22 . 19 3 . 8 4 . 11 5 1 . 9 . 9 7 15 . . . 13 8 5 . . . 4 site 2 . 5 . 5 Weighted motif model: POS A C G T Prob 1 0.391443 0.018125 0.562023 0.028409 0.891441 2 0.027807 0.018125 0.925659 0.028409 1.913088 3 0.027807 0.563580 0.380205 0.028409 1.053749 5 0.391443 0.018125 0.562023 0.028409 0.891441 7 0.936898 0.018125 0.016568 0.028409 1.294744 8 0.573261 0.109034 0.016568 0.301136 0.351173 Conservedness in bits: 6.395638 Conservedness in prob: 9.614316 Concensus sequence: GGCGAA Complete log-likelihood ratio = 84 bits Missing position information = 57 bits Log-likelihood ratio statistic = 26 bits Degrees of freedom = 18 Information per parameter = 1.47 bits MOTIF E 1-1 595 gatccgattc TTACTCCAT atcatgccat 603 1.000000 2-1 465 cgttgcctca TCAATGCGA gatccgttta 473 1.000000 3-1 540 tggcattata CTCCTGCTA gaaagttaac 548 1.000000 4-1 423 gctaatccgg TCACTGCCA ctgctgctac 431 1.000000 5-1 111 tgagaatatt TCAGTTCGT aagagagaag 119 1.000000 6-1 368 tcactcacaa CTATTGCGA agcgcttcag 376 1.000000 7-1 69 aatggtcttg GTAATTCCT ttgcgctaga 77 1.000000 8-1 201 taatcatatt ACATGGCAT taccaccata 209 1.000000 9-1 345 GGAaatggag TCCGTGCGA gttttgttag 353 1.000000 10-1 300 agttcttggc AAGTTGCCA actgacgaga 308 1.000000 sites: * * *** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 595 603 599 -w 1.000000 >2 465 473 469 -w 1.000000 >3 540 548 544 -w 1.000000 >4 423 431 427 -w 1.000000 >5 111 119 115 -w 1.000000 >6 368 376 372 -w 1.000000 >7 69 77 73 -w 1.000000 >8 201 209 205 -w 1.000000 >9 345 353 349 -w 1.000000 >10 300 308 304 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 48 0.1 3 66 . . . 0.6 5 . . . 85 1.0 6 . . 65 . 0.9 7 . 93 . . 1.8 9 57 . . 39 0.5 non- site . 19 . . site . 25 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 3 1 3 7 . . . 6 5 . . . 12 10 6 . . 12 . 9 7 . 21 . . 18 9 5 . . 1 5 site . 1 . . 0 Weighted motif model: POS A C G T Prob 1 0.209625 0.199943 0.107477 0.482955 0.107973 3 0.664170 0.199943 0.107477 0.028409 0.563605 5 0.027807 0.018125 0.107477 0.846591 0.976452 6 0.027807 0.109034 0.652932 0.210227 0.890694 7 0.027807 0.927216 0.016568 0.028409 1.804236 9 0.573261 0.018125 0.016568 0.392045 0.527763 Conservedness in bits: 4.870723 Conservedness in prob: 8.149137 Concensus sequence: TATGCA Complete log-likelihood ratio = 63 bits Missing position information = 58 bits Log-likelihood ratio statistic = 4 bits Degrees of freedom = 18 Information per parameter = 0.253 bits MOTIF F 1-1 439 ctaatcactt CCGAGC gattaataca 444 1.000000 2-1 587 aatcgccatg CCAAGC catcacacgg 592 1.000000 3-1 468 aaGGCAGTAT CGGGGC ggatcactcc 473 1.000000 4-1 82 ttgtcttcaa TACGGC agccgttgtc 87 1.000000 5-1 678 aattgcttta CTGGGC gtataaaacc 683 1.000000 6-1 522 agctatactt CGGAGC actgttgagc 527 1.000000 7-1 483 cagtgcggcg CGAGGC acatctgcgt 488 1.000000 8-1 121 cactTTGTAA CTGAGC tgtcatttat 126 1.000000 9-1 332 GAAaaaggtc CGGGGA aatggagTCC 337 1.000000 10-1 248 ttattgtacg TGGGGC agttgacgtc 253 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 439 444 441 -w 1.000000 >2 587 592 589 -w 1.000000 >3 468 473 470 -w 1.000000 >4 82 87 84 -w 1.000000 >5 678 683 680 -w 1.000000 >6 522 527 524 -w 1.000000 >7 483 488 485 -w 1.000000 >8 121 126 123 -w 1.000000 >9 332 337 334 -w 1.000000 >10 248 253 250 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 75 . . 1.1 2 . . 47 . 0.4 3 . . 65 . 0.9 4 39 . 56 . 0.9 5 . . 93 . 1.9 6 . 84 . . 1.4 non- site . 19 18 . site . 33 46 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 14 . . 11 2 . . 6 . 4 3 . . 12 . 9 4 1 . 9 . 9 5 . . 22 . 19 6 . 17 . . 14 site . 2 6 . 6 Weighted motif model: POS A C G T Prob 1 0.027807 0.745398 0.016568 0.210227 1.144396 2 0.118716 0.199943 0.471114 0.210227 0.363992 3 0.209625 0.109034 0.652932 0.028409 0.894567 4 0.391443 0.018125 0.562023 0.028409 0.891441 5 0.027807 0.018125 0.925659 0.028409 1.913088 6 0.118716 0.836307 0.016568 0.028409 1.412247 Conservedness in bits: 6.619731 Conservedness in prob: 11.151515 Concensus sequence: CGGGGC Complete log-likelihood ratio = 85 bits Missing position information = 61 bits Log-likelihood ratio statistic = 23 bits Degrees of freedom = 18 Information per parameter = 1.31 bits MOTIF G 1-1 183 gtaagttccc AACCCCAG tttctcacaa 190 1.000000 2-1 716 ccacattgac AACCCCAG gtattcatac 723 1.000000 3-1 618 aaaacaaaca TTTCGCAG gctaaaatgt 625 1.000000 4-1 53 gatggtgctt ATCCTCAT gtcttttggg 60 1.000000 5-1 280 cactttctaa AGTCCCAG aaatccgctt 287 1.000000 6-1 540 tgttgagcga AGGCTCAT tagatatatt 547 1.000000 7-1 345 CTAAAAaact AATCGCAT tatcatccta 352 1.000000 8-1 266 aaatgtaaag AGCCCCAT tatcttagcc 273 1.000000 9-1 516 ttttttttca TCCCACAT tttattgctg 523 1.000000 10-1 736 ctctaaagca TACCCCAT agagaagatc 743 1.000000 sites: * ** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 183 190 186 -w 1.000000 >2 716 723 719 -w 1.000000 >3 618 625 621 -w 1.000000 >4 53 60 56 -w 1.000000 >5 280 287 283 -w 1.000000 >6 540 547 543 -w 1.000000 >7 345 352 348 -w 1.000000 >8 266 273 269 -w 1.000000 >9 516 523 519 -w 1.000000 >10 736 743 739 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 66 . . . 0.6 3 . 56 . . 0.7 4 . 93 . . 1.8 6 . 93 . . 1.8 7 94 . . . 1.3 8 . . 38 57 0.7 non- site . 19 . . site . 43 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 7 . . . 6 3 . 8 . . 7 4 . 21 . . 18 6 . 21 . . 18 7 15 . . . 13 8 . . 4 5 7 site . 5 . . 2 Weighted motif model: POS A C G T Prob 1 0.664170 0.018125 0.016568 0.301136 0.606837 3 0.027807 0.563580 0.107477 0.301136 0.650708 4 0.027807 0.927216 0.016568 0.028409 1.804236 6 0.027807 0.927216 0.016568 0.028409 1.804236 7 0.936898 0.018125 0.016568 0.028409 1.294744 8 0.027807 0.018125 0.380205 0.573864 0.747638 Conservedness in bits: 6.908400 Conservedness in prob: 9.728394 Concensus sequence: ACCCAG Complete log-likelihood ratio = 90 bits Missing position information = 69 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.15 bits MOTIF H 1-1 467 tctccatctt TTTAAA tacctttttt 472 1.000000 2-1 351 agtgacacat ATTAAA cacagtggtt 356 1.000000 3-1 225 tcaaactcca ATTAAA tgcggtagaa 230 1.000000 4-1 279 tccatcgaca ATTCAA gatACAGAAc 284 1.000000 5-1 261 tttttttttt TTTAAA tttcactttc 266 1.000000 6-1 769 catcaacatg ATAAAA aaaaacagtt 774 1.000000 7-1 742 taatatgatt ATTAAA cttctttgcg 747 1.000000 8-1 144 tatattgaat TTTCAA aaattcttac 149 1.000000 9-1 671 ttaaggaaac ATACAA aaagatttgt 676 1.000000 10-1 151 atccacaaac TTTAAA acacagggac 156 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 467 472 469 -w 1.000000 >2 351 356 353 -w 1.000000 >3 225 230 227 -w 1.000000 >4 279 284 281 -w 1.000000 >5 261 266 263 -w 1.000000 >6 769 774 771 -w 1.000000 >7 742 747 744 -w 1.000000 >8 144 149 146 -w 1.000000 >9 671 676 673 -w 1.000000 >10 151 156 153 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 57 . . 39 0.5 2 . . . 94 1.3 3 . . . 76 0.7 4 66 29 . . 0.7 5 94 . . . 1.3 6 94 . . . 1.3 non- site 30 . . 31 site 58 . . 36 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 5 . . 1 5 2 . . . 15 13 3 . . . 10 7 4 7 2 . . 7 5 15 . . . 13 6 15 . . . 13 site 5 . . 1 5 Weighted motif model: POS A C G T Prob 1 0.573261 0.018125 0.016568 0.392045 0.527763 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.209625 0.018125 0.016568 0.755682 0.728388 4 0.664170 0.290852 0.016568 0.028409 0.745810 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 5.861138 Conservedness in prob: 8.113646 Concensus sequence: ATTAAA Complete log-likelihood ratio = 78 bits Missing position information = 54 bits Log-likelihood ratio statistic = 23 bits Degrees of freedom = 18 Information per parameter = 1.29 bits MOTIF I 1-1 115 tttcattgct TCCGAA gttttgatca 120 1.000000 2-1 214 catacctctc TCCGTA tcctcgtaat 219 1.000000 3-1 36 gtaatatgtc TCCTAC aataccagtt 41 1.000000 4-1 288 aATTCAAgat ACAGAA cctcctccag 293 1.000000 5-1 511 tttcgccttc TCAGAA aggggtagaa 516 1.000000 6-1 629 ttgaccgtga TCCGAA ggactggcta 634 1.000000 7-1 582 cggcttctaa TCCGTA cttcaatata 587 1.000000 8-1 462 gccgcactgc TCCGAA caataaagat 467 1.000000 9-1 295 ctaaaattat TCCGAA attattccct 300 1.000000 10-1 550 tcgtatgaca TCAGAA tgaaaaaTTT 555 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 115 120 117 -w 1.000000 >2 214 219 216 -w 1.000000 >3 36 41 38 -w 1.000000 >4 288 293 290 -w 1.000000 >5 511 516 513 -w 1.000000 >6 629 634 631 -w 1.000000 >7 582 587 584 -w 1.000000 >8 462 467 464 -w 1.000000 >9 295 300 297 -w 1.000000 >10 550 555 552 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 0.9 2 . 93 . . 1.8 3 . 65 . . 1.0 4 . . 83 . 1.5 5 76 . . . 0.7 6 85 . . . 1.0 non- site 30 19 . . site 35 30 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 9 2 . 21 . . 18 3 . 11 . . 10 4 . . 18 . 15 5 10 . . . 7 6 12 . . . 10 site 1 2 . . 1 Weighted motif model: POS A C G T Prob 1 0.118716 0.018125 0.016568 0.846591 0.935119 2 0.027807 0.927216 0.016568 0.028409 1.804236 3 0.300534 0.654489 0.016568 0.028409 0.959138 4 0.027807 0.018125 0.834750 0.119318 1.507995 5 0.755080 0.018125 0.016568 0.210227 0.744138 6 0.845989 0.109034 0.016568 0.028409 0.991122 Conservedness in bits: 6.941749 Conservedness in prob: 10.336921 Concensus sequence: TCCGAA Complete log-likelihood ratio = 89 bits Missing position information = 70 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.07 bits MOTIF J 1-1 327 ttaaccaaat CTTGATG tctgttaact 333 1.000000 2-1 253 ttatcgtctt TTCGCTG taaaaacttt 259 1.000000 3-1 691 ggattgaaaa TTTGGTG ttgtgaattg 697 1.000000 4-1 18 tacgttttga CTTGGTG ctcgaagatg 24 1.000000 5-1 224 acattttttt TTTTTTG gaagtatgac 230 1.000000 6-1 146 aacacataga TTTGCTG tataacgaat 152 1.000000 7-1 182 ttaacaattt TTTGTTG atacttttat 188 1.000000 8-1 163 ttcttacttt TTTTTTG gatggacgca 169 1.000000 9-1 41 ctgatcaata TTTGATG gaaaaatatg 47 1.000000 10-1 348 cgtcttgaaa CTTTTTG tccttttttt 354 1.000000 sites: **** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 327 333 330 -w 1.000000 >2 253 259 256 -w 1.000000 >3 691 697 694 -w 1.000000 >4 18 24 21 -w 1.000000 >5 224 230 227 -w 1.000000 >6 146 152 149 -w 1.000000 >7 182 188 185 -w 1.000000 >8 163 169 166 -w 1.000000 >9 41 47 44 -w 1.000000 >10 348 354 351 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 29 . 66 0.7 2 . . . 94 1.3 3 . . . 85 1.0 4 . . 65 . 1.0 6 . . . 94 1.3 7 . . 93 . 1.9 non- site . . 18 31 site . . 28 65 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 2 . 7 7 2 . . . 15 13 3 . . . 12 10 4 . . 12 . 10 6 . . . 15 13 7 . . 22 . 19 site . . 2 7 8 Weighted motif model: POS A C G T Prob 1 0.027807 0.290852 0.016568 0.664773 0.728885 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.109034 0.016568 0.846591 0.968787 4 0.027807 0.018125 0.652932 0.301136 1.027066 6 0.027807 0.018125 0.016568 0.937500 1.269688 7 0.027807 0.018125 0.925659 0.028409 1.913088 Conservedness in bits: 7.177202 Conservedness in prob: 9.882314 Concensus sequence: TTTGTG Complete log-likelihood ratio = 94 bits Missing position information = 59 bits Log-likelihood ratio statistic = 34 bits Degrees of freedom = 18 Information per parameter = 1.94 bits seed 7 time: 7 seconds (0.12 minutes) MOTIF A 1-1 463 catatctcca TCTTTT tAAATACCTT 468 1.000000 2-1 249 gtatttatcg TCTTTT cgctgtaaaa 254 1.000000 3-1 315 tgcaatttct TTTTCT attagtagct 320 1.000000 4-1 198 tgggcaagtg TCTTTT tatgtatcgt 203 1.000000 5-1 217 cagttctaca TTTTTT tTTTTTTGGA 222 1.000000 6-1 117 gcactctata TCTTTT agttcttaat 122 1.000000 7-1 641 caaagagaag GTTTTT ttaggctaag 646 1.000000 8-1 162 attcttactt TTTTTT tggatggacg 167 1.000000 9-1 24 attgccaagg TTTTCT actgatcaat 29 1.000000 10-1 362 ttgtcctttt TTTTTT ccggggactc 367 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 463 468 465 -w 1.000000 >2 249 254 251 -w 1.000000 >3 315 320 317 -w 1.000000 >4 198 203 200 -w 1.000000 >5 217 222 219 -w 1.000000 >6 117 122 119 -w 1.000000 >7 641 646 643 -w 1.000000 >8 162 167 164 -w 1.000000 >9 24 29 26 -w 1.000000 >10 362 367 364 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 1.0 2 . 38 . 57 0.7 3 . . . 94 1.3 4 . . . 94 1.3 5 . . . 76 0.8 6 . . . 94 1.3 non- site . . . 31 site . . . 88 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 10 2 . 4 . 5 7 3 . . . 15 13 4 . . . 15 13 5 . . . 10 8 6 . . . 15 13 site . . . 13 12 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.107477 0.846591 0.976452 2 0.027807 0.381761 0.016568 0.573864 0.707463 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.199943 0.016568 0.755682 0.809989 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.302967 Conservedness in prob: 8.403806 Concensus sequence: TCTTTT Complete log-likelihood ratio = 84 bits Missing position information = 58 bits Log-likelihood ratio statistic = 25 bits Degrees of freedom = 18 Information per parameter = 1.41 bits MOTIF B 1-1 554 CCGGAATAta TCTTTT cgggaagctc 559 1.000000 2-1 17 aatcatttgg CTTTTT gattgattgt 22 1.000000 3-1 97 cataacgggc TGTACT aatccaagga 102 1.000000 4-1 784 tggtttcccg TTCTTT ccactcccgt 789 1.000000 5-1 224 acaTTTTTTt TTTTTT GGAAGTATGA 229 1.000000 6-1 490 attcttaaat TGCTTT gcctctcctt 495 1.000000 7-1 136 tagtcattat AGTTTT ttctccttga 141 1.000000 8-1 591 atgcgattag TTTTTT agccttattt 596 1.000000 9-1 301 ttattccgaa ATTATT ccctagaaca 306 1.000000 10-1 2 t CTCATT tttttctact 7 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 554 559 556 -w 1.000000 >2 17 22 19 -w 1.000000 >3 97 102 99 -w 1.000000 >4 784 789 786 -w 1.000000 >5 224 229 226 -w 1.000000 >6 490 495 492 -w 1.000000 >7 136 141 138 -w 1.000000 >8 591 596 593 -w 1.000000 >9 301 306 303 -w 1.000000 >10 2 7 4 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 57 0.3 2 . . 29 57 0.5 3 . 29 . 66 0.7 4 . . . 66 0.6 5 . . . 85 1.0 6 . . . 94 1.3 non- site . . . 31 site . . . 75 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 5 3 2 . . 2 5 5 3 . 2 . 7 7 4 . . . 7 6 5 . . . 12 10 6 . . . 15 13 site . . . 9 6 Weighted motif model: POS A C G T Prob 1 0.209625 0.199943 0.016568 0.573864 0.332425 2 0.027807 0.109034 0.289295 0.573864 0.504913 3 0.027807 0.290852 0.016568 0.664773 0.728885 4 0.300534 0.018125 0.016568 0.664773 0.596285 5 0.027807 0.109034 0.016568 0.846591 0.968787 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 4.400982 Conservedness in prob: 6.954485 Concensus sequence: TTTTTT Complete log-likelihood ratio = 59 bits Missing position information = 49 bits Log-likelihood ratio statistic = 9 bits Degrees of freedom = 18 Information per parameter = 0.525 bits MOTIF C 1-1 544 atttttgggc CCGGAATA taTCTTTTcg 551 1.000000 2-1 327 tctacgctga CAGTAATA tcaaacagtg 334 1.000000 3-1 24 tccaagacga CAGTAATA tgtctcctac 31 1.000000 4-1 572 cttctctccc CTGCAATA taatagttta 579 1.000000 5-1 783 gctctcatta CTAAATTA agatagaaaa 790 1.000000 6-1 728 aaaagcaggt CGGAAATA tttatgggca 735 1.000000 7-1 324 ttaattaccc CAGAAATA aggctaaaaa 331 1.000000 8-1 310 ttggaacttt CAGTAATA cgcttaactg 317 1.000000 9-1 747 aaaccacaag CAGCAATA caaagagaat 754 1.000000 10-1 43 acaaaatacg CAATAATA acgagtagta 50 1.000000 sites: * * **** 5 (10 sites in 10 sequences) Conservedness in sites: >1 544 551 547 -w 1.000000 >2 327 334 330 -w 1.000000 >3 24 31 27 -w 1.000000 >4 572 579 575 -w 1.000000 >5 783 790 786 -w 1.000000 >6 728 735 731 -w 1.000000 >7 324 331 327 -w 1.000000 >8 310 317 313 -w 1.000000 >9 747 754 750 -w 1.000000 >10 43 50 46 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 3 . . 74 . 1.2 5 94 . . . 1.3 6 85 . . . 1.0 7 . . . 94 1.3 8 94 . . . 1.3 non- site 30 . . . site 51 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 3 . . 15 . 12 5 15 . . . 13 6 12 . . . 10 7 . . . 15 13 8 15 . . . 13 site 4 . . . 1 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 3 0.209625 0.018125 0.743841 0.028409 1.234055 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.845989 0.018125 0.016568 0.119318 0.955898 7 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 7.853365 Conservedness in prob: 10.529053 Concensus sequence: CGAATA Complete log-likelihood ratio = 102 bits Missing position information = 75 bits Log-likelihood ratio statistic = 27 bits Degrees of freedom = 18 Information per parameter = 1.51 bits MOTIF D 1-1 263 ttgaagaagg TCTTGTGTTTG gctgttgccg 273 1.000000 2-1 725 caaccccagg TATTCATACTT cctattagcg 735 1.000000 3-1 71 aaggcacatc TATTACATTTA ctgagcataa 81 1.000000 4-1 695 agctcataac TTTTTTTTTTG aacctgaata 705 1.000000 5-1 254 tgttaaattt TTTTTTTTTTA aatttcactt 264 1.000000 6-1 349 catttcgtta CTTTTGATATC actcacaact 359 1.000000 7-1 181 attaacaatt TTTTGTTGATA cttttatgac 191 1.000000 8-1 635 gaagcgatga TTTTTGATCTA ttaacagata 645 1.000000 9-1 504 gtgccttttt TTTTTTTTTTC atcccacatt 514 1.000000 10-1 563 gaatgaaaaa TTTTCAAGTTA gacaaggaca 573 1.000000 sites: * ** * ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 263 273 268 -w 1.000000 >2 725 735 730 -w 1.000000 >3 71 81 76 -w 1.000000 >4 695 705 700 -w 1.000000 >5 254 264 259 -w 1.000000 >6 349 359 354 -w 1.000000 >7 181 191 186 -w 1.000000 >8 635 645 640 -w 1.000000 >9 504 514 509 -w 1.000000 >10 563 573 568 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 1.0 3 . . . 94 1.3 4 . . . 94 1.3 8 . . . 66 0.5 10 . . . 94 1.3 11 48 . . . 0.2 non- site . . . 31 site . . . 78 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 10 3 . . . 15 13 4 . . . 15 13 8 . . . 7 5 10 . . . 15 13 11 3 . . . 2 site . . . 10 7 Weighted motif model: POS A C G T Prob 1 0.027807 0.109034 0.016568 0.846591 0.968787 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.118716 0.018125 0.198386 0.664773 0.523422 10 0.027807 0.018125 0.016568 0.937500 1.269688 11 0.482352 0.199943 0.198386 0.119318 0.176340 Conservedness in bits: 5.477612 Conservedness in prob: 7.938846 Concensus sequence: TTTTTA Complete log-likelihood ratio = 72 bits Missing position information = 59 bits Log-likelihood ratio statistic = 12 bits Degrees of freedom = 18 Information per parameter = 0.696 bits MOTIF E 1-1 506 ctaagtagta AAAGTAT tatgcatagt 512 1.000000 2-1 404 gtcgtcaagt AAAGATT tcgtgttcat 410 1.000000 3-1 765 taagtaaaca CAAGATT aacataataa 771 1.000000 4-1 524 ttaaatggcg CAAGTTT tccgctttgt 530 1.000000 5-1 299 aatccgcttg AATGTCT tacatattgc 305 1.000000 6-1 51 cttacgggtc CAAGATT gtctacagaT 57 1.000000 7-1 692 aacatataag TAAGATT agatatggat 698 1.000000 8-1 472 tccgaacaat AAAGATT ctacaatact 478 1.000000 9-1 677 aaacatacaa AAAGATT tgttcaTTTC 683 1.000000 10-1 126 gttttcaatg TAAGAGA tttcgattat 132 1.000000 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 506 512 509 -w 1.000000 >2 404 410 407 -w 1.000000 >3 765 771 768 -w 1.000000 >4 524 530 527 -w 1.000000 >5 299 305 302 -w 1.000000 >6 51 57 54 -w 1.000000 >7 692 698 695 -w 1.000000 >8 472 478 475 -w 1.000000 >9 677 683 680 -w 1.000000 >10 126 132 129 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 48 29 . . 0.3 2 94 . . . 1.3 3 85 . . . 1.0 4 . . 93 . 1.9 5 66 . . . 0.6 7 . . . 85 0.9 non- site 30 . . . site 53 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 3 2 . . 3 2 15 . . . 13 3 12 . . . 10 4 . . 22 . 19 5 7 . . . 6 7 . . . 12 9 site 4 . . . 2 Weighted motif model: POS A C G T Prob 1 0.482352 0.290852 0.016568 0.210227 0.297885 2 0.936898 0.018125 0.016568 0.028409 1.294744 3 0.845989 0.018125 0.016568 0.119318 0.955898 4 0.027807 0.018125 0.925659 0.028409 1.913088 5 0.664170 0.018125 0.016568 0.301136 0.606837 7 0.118716 0.018125 0.016568 0.846591 0.935119 Conservedness in bits: 6.003572 Conservedness in prob: 8.640773 Concensus sequence: AAAGAT Complete log-likelihood ratio = 78 bits Missing position information = 60 bits Log-likelihood ratio statistic = 17 bits Degrees of freedom = 18 Information per parameter = 1 bits MOTIF F 1-1 211 cgatgacttg TACGGTAA ggtcactgat 218 1.000000 2-1 111 gagaatgttc ACAGGCGC atacgctaca 118 1.000000 3-1 51 caataccagt TTCGCTGC agaaggcaca 58 1.000000 4-1 394 gtgcaagcat AGTGGGGC cttcttccaa 401 1.000000 5-1 419 aagttataac ACCGGCGA acaatcgggg 426 1.000000 6-1 31 aaccttgaaa AACGGTGA aacttacggg 38 1.000000 7-1 476 ttcggagcag TGCGGCGC gaggcacatc 483 1.000000 8-1 434 gcgttcctga AACGCAGA tgtgcctcgc 441 1.000000 9-1 330 gggaaaaagg TCCGGGGA aatggagtcc 337 1.000000 10-1 188 tatgctttca ACCGCTGC gttttggata 195 1.000000 sites: * *** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 211 218 214 -w 1.000000 >2 111 118 114 -w 1.000000 >3 51 58 54 -w 1.000000 >4 394 401 397 -w 1.000000 >5 419 426 422 -w 1.000000 >6 31 38 34 -w 1.000000 >7 476 483 479 -w 1.000000 >8 434 441 437 -w 1.000000 >9 330 337 333 -w 1.000000 >10 188 195 191 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 57 . . 39 0.5 3 . 75 . . 1.0 4 . . 93 . 1.9 5 . 29 65 . 1.2 7 . . 83 . 1.5 8 48 47 . . 0.8 non- site . 19 18 . site . 26 43 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 5 . . 1 5 3 . 14 . . 10 4 . . 22 . 19 5 . 2 12 . 12 7 . . 18 . 15 8 3 6 . . 8 site . 1 5 . 4 Weighted motif model: POS A C G T Prob 1 0.573261 0.018125 0.016568 0.392045 0.527763 3 0.118716 0.745398 0.016568 0.119318 1.032986 4 0.027807 0.018125 0.925659 0.028409 1.913088 5 0.027807 0.290852 0.652932 0.028409 1.166038 7 0.118716 0.018125 0.834750 0.028409 1.509552 8 0.482352 0.472670 0.016568 0.028409 0.750020 Conservedness in bits: 6.899447 Conservedness in prob: 10.435128 Concensus sequence: ACGGGC Complete log-likelihood ratio = 89 bits Missing position information = 60 bits Log-likelihood ratio statistic = 28 bits Degrees of freedom = 18 Information per parameter = 1.61 bits MOTIF G 1-1 172 gtccaaggct GGTAAGTTCCCAAC cccagtttct 185 1.000000 2-1 36 tgattgtaca GGAAAATATACATC gcagggggtt 49 1.000000 3-1 272 acgtcaattc GGAAAGCTTCCTTC cggaatggct 285 1.000000 4-1 214 tatgtatcgt GGAATTTATCCTGC tggtcttctg 227 1.000000 5-1 230 TTTtTTTTTT GGAAGTATGACCTC tgttaaattt 243 1.000000 6-1 450 aagtagaggg GGTAATTTTTCCCC tttattttgt 463 1.000000 7-1 98 attgaactca GGTACAATCACTTC ttctgaatga 111 1.000000 8-1 611 ttatttctgg GGTAATTAATCAGC gaagcgatga 624 1.000000 9-1 221 atcagcaaat GGCAGAATAACGCG gtactaacca 234 1.000000 10-1 297 cgaagttctt GGCAAGTTGCCAAC tgacgagatg 310 1.000000 sites: ** * * * * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 172 185 178 -w 1.000000 >2 36 49 42 -w 1.000000 >3 272 285 278 -w 1.000000 >4 214 227 220 -w 1.000000 >5 230 243 236 -w 1.000000 >6 450 463 456 -w 1.000000 >7 98 111 104 -w 1.000000 >8 611 624 617 -w 1.000000 >9 221 234 227 -w 1.000000 >10 297 310 303 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 93 . 1.9 2 . . 93 . 1.9 4 94 . . . 1.3 8 . . . 66 0.6 11 . 93 . . 1.8 14 . 84 . . 1.5 non- site . 19 18 . site . 31 35 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 22 . 19 2 . . 22 . 19 4 15 . . . 13 8 . . . 7 6 11 . 21 . . 18 14 . 17 . . 15 site . 2 3 . 3 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.925659 0.028409 1.913088 2 0.027807 0.018125 0.925659 0.028409 1.913088 4 0.936898 0.018125 0.016568 0.028409 1.294744 8 0.300534 0.018125 0.016568 0.664773 0.596285 11 0.027807 0.927216 0.016568 0.028409 1.804236 14 0.027807 0.836307 0.107477 0.028409 1.453580 Conservedness in bits: 8.975021 Conservedness in prob: 11.679047 Concensus sequence: GGATCC Complete log-likelihood ratio = 116 bits Missing position information = 82 bits Log-likelihood ratio statistic = 34 bits Degrees of freedom = 18 Information per parameter = 1.89 bits MOTIF H 1-1 470 ccaTCTTTTt AAATACCTTTTTTAATACG tatgactcta 488 1.000000 2-1 508 cacttacccc ACGTTCGGTCCACTGTGTG ccgaacatgc 526 1.000000 3-1 558 agaaagttaa CTGTGCACATATTCTTAAA ttatacaaca 576 1.000000 4-1 424 ctaatccggt CACTGCCACTGCTGCTACG gaAAACCAAC 442 1.000000 5-1 13 cttagtatct CATCTCATCTCAATTTCTA tattccacta 31 1.000000 6-1 666 caaaatagcc AAGCTGAAAATAATGTGTA gctatgttca 684 1.000000 7-1 7 cggttt AGCATCATAAGCGCTTATA aatttcttaa 25 1.000000 8-1 743 tcataaaagt ATCAACAAAAAATTGTTAA tatacctcta 761 1.000000 9-1 385 cacacatttc CTCATCTTATAATTTTGTG gaaaaattca 403 1.000000 10-1 387 ctacgagaac CCTTTGTCCTACTGATTAA ttttgtactg 405 1.000000 sites: * ** * * * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 470 488 479 -w 1.000000 >2 508 526 517 -w 1.000000 >3 558 576 567 -w 1.000000 >4 424 442 433 -w 1.000000 >5 13 31 22 -w 1.000000 >6 666 684 675 -w 1.000000 >7 7 25 16 -w 1.000000 >8 743 761 752 -w 1.000000 >9 385 403 394 -w 1.000000 >10 387 405 396 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 48 47 . . 0.8 5 . . . 57 0.4 6 . 75 . . 1.2 10 . . . 57 0.3 16 . . . 94 1.3 19 57 . 38 . 0.8 non- site . 19 . 31 site . 23 . 36 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 3 6 . . 8 5 . . . 5 4 6 . 14 . . 12 10 . . . 5 3 16 . . . 15 13 19 5 . 4 . 8 site . 1 . 1 0 Weighted motif model: POS A C G T Prob 1 0.482352 0.472670 0.016568 0.028409 0.750020 5 0.209625 0.018125 0.198386 0.573864 0.350499 6 0.027807 0.745398 0.198386 0.028409 1.247945 10 0.300534 0.109034 0.016568 0.573864 0.343303 16 0.027807 0.018125 0.016568 0.937500 1.269688 19 0.573261 0.018125 0.380205 0.028409 0.761880 Conservedness in bits: 4.723334 Conservedness in prob: 7.547399 Concensus sequence: CTCTTG Complete log-likelihood ratio = 62 bits Missing position information = 51 bits Log-likelihood ratio statistic = 11 bits Degrees of freedom = 18 Information per parameter = 0.643 bits MOTIF I 1-1 672 gccttacttt AAAAGCATGT tgagtgaatt 681 1.000000 2-1 354 gacacatatt AAACACAGTG gtttctttgc 363 1.000000 3-1 609 attgttcaaa AAACAAACAT ttcgcaggct 618 1.000000 4-1 445 CTGCTACGga AAACCAACCT aaaggtatta 454 1.000000 5-1 548 cgcagattgc AAACACGGCT taataatatg 557 1.000000 6-1 390 gcttcagtga AAAAATCATA aggaaaagtt 399 1.000000 7-1 745 tatgattatt AAACTTCTTT gcgtccatcc 754 1.000000 8-1 537 ctggccccac AAACCTTCAA attaacgaat 546 1.000000 9-1 594 ctttcttctc AAACTTTGTA atgcgcctgt 603 1.000000 10-1 706 catctgtata AAACTCCTTT cttaaTTTCA 715 1.000000 sites: **** * * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 672 681 676 -w 1.000000 >2 354 363 358 -w 1.000000 >3 609 618 613 -w 1.000000 >4 445 454 449 -w 1.000000 >5 548 557 552 -w 1.000000 >6 390 399 394 -w 1.000000 >7 745 754 749 -w 1.000000 >8 537 546 541 -w 1.000000 >9 594 603 598 -w 1.000000 >10 706 715 710 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 94 . . . 1.3 3 94 . . . 1.3 4 . 75 . . 1.1 6 . 38 . 39 0.3 10 . . . 57 0.4 non- site 30 . . . site 61 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 15 . . . 13 3 15 . . . 13 4 . 14 . . 11 6 . 4 . 1 3 10 . . . 5 4 site 6 . . . 4 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.936898 0.018125 0.016568 0.028409 1.294744 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.209625 0.745398 0.016568 0.028409 1.148270 6 0.209625 0.381761 0.016568 0.392045 0.314455 10 0.300534 0.018125 0.107477 0.573864 0.350968 Conservedness in bits: 5.697926 Conservedness in prob: 8.561412 Concensus sequence: AAACCT Complete log-likelihood ratio = 75 bits Missing position information = 54 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.14 bits MOTIF J 1-1 13 cagagctaag TCTTGCGG tgttgacgct 20 1.000000 2-1 151 ttgctagcct TTTCTCGG tcttgcaaac 158 1.000000 3-1 705 gtgttgtgaa TTGCTCTT cattatgcac 712 1.000000 4-1 637 accggcgcac TCTCGCCC gaacgacctc 644 1.000000 5-1 473 agggcggtct TTTCTCCC tcattgtcat 480 1.000000 6-1 67 Tgtctacaga TTTTCCTG atttgccagc 74 1.000000 7-1 419 tactgccaat TTTTCCTC ttcataacca 426 1.000000 8-1 108 ttagaagtac TTTCACTT tgtaactgag 115 1.000000 9-1 690 GATTtgttca TTTCACTC caagtatttt 697 1.000000 10-1 721 CCTTTcttaa TTTCACTC taaagcatac 728 1.000000 sites: **** * * 5 (10 sites in 10 sequences) Conservedness in sites: >1 13 20 16 -w 1.000000 >2 151 158 154 -w 1.000000 >3 705 712 708 -w 1.000000 >4 637 644 640 -w 1.000000 >5 473 480 476 -w 1.000000 >6 67 74 70 -w 1.000000 >7 419 426 422 -w 1.000000 >8 108 115 111 -w 1.000000 >9 690 697 693 -w 1.000000 >10 721 728 724 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 76 0.8 3 . . . 85 1.0 4 . 65 . . 1.0 6 . 93 . . 1.8 8 . 47 29 . 0.6 non- site . 19 . 31 site . 40 . 53 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 10 8 3 . . . 12 10 4 . 11 . . 10 6 . 21 . . 18 8 . 6 2 . 6 site . 4 . 4 7 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.199943 0.016568 0.755682 0.809989 3 0.027807 0.018125 0.107477 0.846591 0.976452 4 0.027807 0.654489 0.016568 0.301136 0.952767 6 0.027807 0.927216 0.016568 0.028409 1.804236 8 0.027807 0.472670 0.289295 0.210227 0.565066 Conservedness in bits: 6.378198 Conservedness in prob: 9.474349 Concensus sequence: TTTCCC Complete log-likelihood ratio = 84 bits Missing position information = 58 bits Log-likelihood ratio statistic = 25 bits Degrees of freedom = 18 Information per parameter = 1.41 bits seed 8 time: 6 seconds (0.10 minutes) MOTIF A 1-1 768 cgcataatat AGGTAT tccatgcgca 773 1.000000 2-1 722 tgacaacccc AGGTAT TCATACTTcc 727 1.000000 3-1 112 taatccaagg AGGTTT acggaccagg 117 1.000000 4-1 457 accaacctaa AGGTAT taacttcTTC 462 1.000000 5-1 352 Tcctggcttt AGATAT ttgaaactta 357 1.000000 6-1 549 aaggctcatt AGATAT attttctgtc 554 1.000000 7-1 165 taaagtatag AGGTAT attaacaatt 170 1.000000 8-1 651 atctattaac AGATAT ataaatggaa 656 1.000000 9-1 63 atatgacata AGGTAT gcgtattagt 68 1.000000 10-1 690 TAtgatgatt AGGTAT catctgtata 695 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 768 773 770 -w 1.000000 >2 722 727 724 -w 1.000000 >3 112 117 114 -w 1.000000 >4 457 462 459 -w 1.000000 >5 352 357 354 -w 1.000000 >6 549 554 551 -w 1.000000 >7 165 170 167 -w 1.000000 >8 651 656 653 -w 1.000000 >9 63 68 65 -w 1.000000 >10 690 695 692 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 . . 93 . 1.9 3 . . 65 . 1.0 4 . . . 94 1.3 5 85 . . . 1.0 6 . . . 94 1.3 non- site 30 . 18 31 site 36 . 28 35 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 . . 22 . 19 3 . . 12 . 10 4 . . . 15 13 5 12 . . . 10 6 . . . 15 13 site 1 . 2 1 3 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.027807 0.018125 0.925659 0.028409 1.913088 3 0.300534 0.018125 0.652932 0.028409 1.033437 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.845989 0.018125 0.016568 0.119318 0.955898 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.736543 Conservedness in prob: 10.438146 Concensus sequence: AGGTAT Complete log-likelihood ratio = 101 bits Missing position information = 73 bits Log-likelihood ratio statistic = 27 bits Degrees of freedom = 18 Information per parameter = 1.55 bits MOTIF B 1-1 579 cggagtatat TGCACCG atccgattct 585 1.000000 2-1 751 tagcggaatc AGGAGTG caaaaagaga 757 1.000000 3-1 375 cggttgcctc AGGAAGG caccggcggt 381 1.000000 4-1 305 ctcctccaga TGGAATC ccttccatag 311 1.000000 5-1 390 aaacttccta TGGAGTG tataagaatt 396 1.000000 6-1 299 tggaaagata TGGACGG tagcaacaag 305 1.000000 7-1 387 Attcgttaat TTGAAGG tttgtggggc 393 1.000000 8-1 168 acTTTTTTtt TGGATGG acgcaaagaa 174 1.000000 9-1 640 attaaaaaac AGCATGG agttttttaa 646 1.000000 10-1 789 ataataagaa TAGGAGG gaata 795 1.000000 sites: **** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 579 585 582 -w 1.000000 >2 751 757 754 -w 1.000000 >3 375 381 378 -w 1.000000 >4 305 311 308 -w 1.000000 >5 390 396 393 -w 1.000000 >6 299 305 302 -w 1.000000 >7 387 393 390 -w 1.000000 >8 168 174 171 -w 1.000000 >9 640 646 643 -w 1.000000 >10 789 795 792 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 66 0.6 2 . . 74 . 1.1 3 . . 74 . 1.3 4 85 . . . 1.0 6 . . 56 . 0.7 7 . . 83 . 1.5 non- site . . 18 . site . . 53 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 7 6 2 . . 15 . 11 3 . . 15 . 13 4 12 . . . 10 6 . . 9 . 7 7 . . 18 . 15 site . . 8 . 5 Weighted motif model: POS A C G T Prob 1 0.300534 0.018125 0.016568 0.664773 0.596285 2 0.118716 0.018125 0.743841 0.119318 1.118771 3 0.027807 0.199943 0.743841 0.028409 1.315655 4 0.845989 0.018125 0.107477 0.028409 0.998787 6 0.027807 0.109034 0.562023 0.301136 0.705899 7 0.027807 0.109034 0.834750 0.028409 1.543220 Conservedness in bits: 6.278616 Conservedness in prob: 10.434987 Concensus sequence: TGGAGG Complete log-likelihood ratio = 81 bits Missing position information = 60 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.14 bits MOTIF C 1-1 125 tccgaagttt TGATCAA gcaagttcca 131 1.000000 2-1 352 gtgacacata TTAAACA cagtggtttc 358 1.000000 3-1 770 aaacacaaga TTAACAT aataaaaaaa 776 1.000000 4-1 470 TATtaacttc TTCACTA taagaaaatc 476 1.000000 5-1 609 cacaccgctg CTCTCCT taattcccta 615 1.000000 6-1 498 Attgctttgc CTCTCCT tttggaaagc 504 1.000000 7-1 579 cggcggcttc TAATCCG tacttcaata 585 1.000000 8-1 392 cgacggaaga CTCTCCT CCGTGCGtcc 398 1.000000 9-1 438 acgagtccat TTCTCCA gtgaaactac 444 1.000000 10-1 512 aaaaaaagct TTCACCG atttcctaga 518 1.000000 sites: *** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 125 131 128 -w 1.000000 >2 352 358 355 -w 1.000000 >3 770 776 773 -w 1.000000 >4 470 476 473 -w 1.000000 >5 609 615 612 -w 1.000000 >6 498 504 501 -w 1.000000 >7 579 585 582 -w 1.000000 >8 392 398 395 -w 1.000000 >9 438 444 441 -w 1.000000 >10 512 518 515 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 29 . 66 0.7 2 . . . 76 0.7 3 39 56 . . 0.8 5 . 84 . . 1.4 6 . 65 . . 0.8 7 39 . . 39 0.2 non- site . 19 . . site . 41 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 2 . 7 7 2 . . . 10 7 3 1 8 . . 8 5 . 17 . . 14 6 . 11 . . 8 7 1 . . 1 2 site . 4 . . 3 Weighted motif model: POS A C G T Prob 1 0.027807 0.290852 0.016568 0.664773 0.728885 2 0.118716 0.018125 0.107477 0.755682 0.655994 3 0.391443 0.563580 0.016568 0.028409 0.828585 5 0.118716 0.836307 0.016568 0.028409 1.412247 6 0.209625 0.654489 0.016568 0.119318 0.785044 7 0.391443 0.018125 0.198386 0.392045 0.229142 Conservedness in bits: 4.639898 Conservedness in prob: 8.001355 Concensus sequence: TTCCCA Complete log-likelihood ratio = 60 bits Missing position information = 39 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.14 bits MOTIF D 1-1 734 TTCAaccata CCTGCTATTA tataatcttc 743 1.000000 2-1 186 ggcagcttag TATATAAATA cacatgtaca 195 1.000000 3-1 623 aaacatttcg CAGGCTAAAA tgtggagata 632 1.000000 4-1 35 ctcgaagatg CTTTCAGAGA tggtgcttat 44 1.000000 5-1 755 tgcatcttag CAAGCTAAAA tttggacagc 764 1.000000 6-1 479 tttgttcata CATTCTTAAA ttgctttgcC 488 1.000000 7-1 760 tctttgcgtc CATCCAAAAA aaaagtaaga 769 1.000000 8-1 770 aatatacctc TATACTTTAA cgtcaaggag 779 1.000000 9-1 197 ctcctccgct CCTCCACTAA aacgatcagc 206 1.000000 10-1 649 ccttttccat TTTCCATTAA atctctgtTC 658 1.000000 sites: * * ** ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 734 743 738 -w 1.000000 >2 186 195 190 -w 1.000000 >3 623 632 627 -w 1.000000 >4 35 44 39 -w 1.000000 >5 755 764 759 -w 1.000000 >6 479 488 483 -w 1.000000 >7 760 769 764 -w 1.000000 >8 770 779 774 -w 1.000000 >9 197 206 201 -w 1.000000 >10 649 658 653 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 65 . . 1.0 3 . . . 76 0.7 5 . 84 . . 1.4 6 48 . . 48 0.5 9 66 . . . 0.5 10 94 . . . 1.3 non- site 30 19 . . site 38 26 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 11 . . 10 3 . . . 10 7 5 . 17 . . 14 6 3 . . 3 5 9 7 . . . 5 10 15 . . . 13 site 1 1 . . 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.654489 0.016568 0.301136 0.952767 3 0.118716 0.018125 0.107477 0.755682 0.655994 5 0.027807 0.836307 0.016568 0.119318 1.410690 6 0.482352 0.018125 0.016568 0.482955 0.500267 9 0.664170 0.018125 0.107477 0.210227 0.478131 10 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 5.292594 Conservedness in prob: 8.448060 Concensus sequence: CTCAAA Complete log-likelihood ratio = 69 bits Missing position information = 55 bits Log-likelihood ratio statistic = 13 bits Degrees of freedom = 18 Information per parameter = 0.759 bits MOTIF E 1-1 721 ggtgttcaat CAGTTCA accataCCTG 727 1.000000 2-1 113 gaatgttcac AGGCGCA tacgctacaa 119 1.000000 3-1 399 ggtctttcgt CCGTGCG gagatatctg 405 1.000000 4-1 629 cttcatttac CGGCGCA ctctcgcccg 635 1.000000 5-1 60 ttcactcttt CTGCGCG cgccaatgtc 66 1.000000 6-1 81 CCTGATTTgc CAGCTTA ctatccttct 87 1.000000 7-1 478 cggagcagtg CGGCGCG aggcacatct 484 1.000000 8-1 399 agaCTCTCCT CCGTGCG tcctcgtctt 405 1.000000 9-1 346 gaaatggagt CCGTGCG agttttgtta 352 1.000000 10-1 757 gaagatcttt CGGTTCG aagacattcc 763 1.000000 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 721 727 724 -w 1.000000 >2 113 119 116 -w 1.000000 >3 399 405 402 -w 1.000000 >4 629 635 632 -w 1.000000 >5 60 66 63 -w 1.000000 >6 81 87 84 -w 1.000000 >7 478 484 481 -w 1.000000 >8 399 405 402 -w 1.000000 >9 346 352 349 -w 1.000000 >10 757 763 760 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.4 3 . . 93 . 1.9 4 . 47 . 48 0.7 5 . . 65 . 1.0 6 . 84 . . 1.4 7 39 . 56 . 0.9 non- site . 19 18 . site . 38 38 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 14 3 . . 22 . 19 4 . 6 . 3 7 5 . . 12 . 10 6 . 17 . . 14 7 1 . 9 . 9 site . 4 4 . 5 Weighted motif model: POS A C G T Prob 1 0.118716 0.836307 0.016568 0.028409 1.412247 3 0.027807 0.018125 0.925659 0.028409 1.913088 4 0.027807 0.472670 0.016568 0.482955 0.738438 5 0.027807 0.018125 0.652932 0.301136 1.027066 6 0.027807 0.836307 0.016568 0.119318 1.410690 7 0.391443 0.018125 0.562023 0.028409 0.891441 Conservedness in bits: 7.392971 Conservedness in prob: 11.192731 Concensus sequence: CGCGCG Complete log-likelihood ratio = 95 bits Missing position information = 66 bits Log-likelihood ratio statistic = 29 bits Degrees of freedom = 18 Information per parameter = 1.63 bits MOTIF F 1-1 68 aacaagaaca AGAAGTT aatcaagaag 74 1.000000 2-1 645 cataggcagt AAAATTT ttactgaaac 651 1.000000 3-1 128 acggaccagg GGAACTT TCCAGATTCa 134 1.000000 4-1 214 tatgtatcgt GGAATTT atcctgctgg 220 1.000000 5-1 247 tgacctctgt TAAATTT tttttttttt 253 1.000000 6-1 403 aatcataagg AAAAGTT gtaaatatta 409 1.000000 7-1 623 gcgtattact GAAAGTT ccaaagagaa 629 1.000000 8-1 302 ccttctcttt GGAACTT tcagtaatac 308 1.000000 9-1 167 aaagcggaaa AAAAGTT atcaccccgc 173 1.000000 10-1 344 ttgccgtctt GAAACTT tttgtccttT 350 1.000000 sites: **** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 68 74 71 -w 1.000000 >2 645 651 648 -w 1.000000 >3 128 134 131 -w 1.000000 >4 214 220 217 -w 1.000000 >5 247 253 250 -w 1.000000 >6 403 409 406 -w 1.000000 >7 623 629 626 -w 1.000000 >8 302 308 305 -w 1.000000 >9 167 173 170 -w 1.000000 >10 344 350 347 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 39 . 47 . 0.6 2 57 . 38 . 0.8 3 94 . . . 1.3 4 94 . . . 1.3 6 . . . 94 1.3 7 . . . 94 1.3 non- site 30 . . 31 site 50 . . 35 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 1 . 6 . 6 2 5 . 4 . 8 3 15 . . . 13 4 15 . . . 13 6 . . . 15 13 7 . . . 15 13 site 4 . . 1 4 Weighted motif model: POS A C G T Prob 1 0.391443 0.018125 0.471114 0.119318 0.556358 2 0.573261 0.018125 0.380205 0.028409 0.761880 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.027807 0.018125 0.016568 0.937500 1.269688 7 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.447103 Conservedness in prob: 8.830837 Concensus sequence: GGAATT Complete log-likelihood ratio = 85 bits Missing position information = 61 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.34 bits MOTIF G 1-1 411 cctccatggg TCCAGCTTT cagattgtac 419 1.000000 2-1 244 ttcttgtatt TATCGTCTT ttcgctgtaa 252 1.000000 3-1 135 aggGGAACTT TCCAGATTC agatcacagc 143 1.000000 4-1 530 ggcgcaagtt TTCCGCTTT gtaatatata 538 1.000000 5-1 141 gatgaagtta TTTGGGCTC tttgctcgag 149 1.000000 6-1 70 ctacagattt TCCTGATTT gcCAGCTTAc 78 1.000000 7-1 259 aaagtggtta TGCAGCTTT tccatttata 267 1.000000 8-1 594 cgattagttt TTTAGCCTT atttctgggg 602 1.000000 9-1 529 cacattttat TGCTGCCTC aatctccatt 537 1.000000 10-1 77 TTATAGTTca TACATGCTT caactactta 85 1.000000 sites: * * * *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 411 419 415 -w 1.000000 >2 244 252 248 -w 1.000000 >3 135 143 139 -w 1.000000 >4 530 538 534 -w 1.000000 >5 141 149 145 -w 1.000000 >6 70 78 74 -w 1.000000 >7 259 267 263 -w 1.000000 >8 594 602 598 -w 1.000000 >9 529 537 533 -w 1.000000 >10 77 85 81 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 3 . 65 . . 1.0 5 . . 83 . 1.5 7 . 47 . 48 0.7 8 . . . 94 1.3 9 . 29 . 66 0.7 non- site . 19 . 31 site . 25 . 60 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 3 . 11 . . 10 5 . . 18 . 15 7 . 6 . 3 7 8 . . . 15 13 9 . 2 . 7 7 site . 1 . 6 6 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.654489 0.016568 0.301136 0.952767 5 0.027807 0.018125 0.834750 0.119318 1.507995 7 0.027807 0.472670 0.016568 0.482955 0.738438 8 0.027807 0.018125 0.016568 0.937500 1.269688 9 0.027807 0.290852 0.016568 0.664773 0.728885 Conservedness in bits: 6.467462 Conservedness in prob: 9.414589 Concensus sequence: TCGCTT Complete log-likelihood ratio = 85 bits Missing position information = 66 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.06 bits MOTIF H 1-1 477 tttaaatacc TTTTTT aatacgtatg 482 1.000000 2-1 150 cttgctagcc TTTTCT cggtcttgca 155 1.000000 3-1 311 aggttgcaat TTCTTT ttctattagt 316 1.000000 4-1 695 agctcataac TTTTTT ttttgaacct 700 1.000000 5-1 217 cagttctaca TTTTTT tttttttgga 222 1.000000 6-1 237 agggaccgaa TTGTTT acaagttctc 242 1.000000 7-1 642 aaagagaagg TTTTTT taggctaaga 647 1.000000 8-1 160 aaattcttac TTTTTT ttTGGATGGa 165 1.000000 9-1 505 tgcctttttt TTTTTT tttcatccca 510 1.000000 10-1 360 Ttttgtcctt TTTTTT ttccggggac 365 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 477 482 479 -w 1.000000 >2 150 155 152 -w 1.000000 >3 311 316 313 -w 1.000000 >4 695 700 697 -w 1.000000 >5 217 222 219 -w 1.000000 >6 237 242 239 -w 1.000000 >7 642 647 644 -w 1.000000 >8 160 165 162 -w 1.000000 >9 505 510 507 -w 1.000000 >10 360 365 362 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 3 . . . 76 0.7 4 . . . 94 1.3 5 . . . 85 1.0 6 . . . 94 1.3 non- site . . . 31 site . . . 95 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 3 . . . 10 7 4 . . . 15 13 5 . . . 12 10 6 . . . 15 13 site . . . 15 14 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.109034 0.107477 0.755682 0.689662 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.109034 0.016568 0.846591 0.968787 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.737201 Conservedness in prob: 9.051582 Concensus sequence: TTTTTT Complete log-likelihood ratio = 89 bits Missing position information = 62 bits Log-likelihood ratio statistic = 27 bits Degrees of freedom = 18 Information per parameter = 1.51 bits MOTIF I 1-1 242 agatctacca TCAAGTTCCAATTGA agaaggtctt 256 1.000000 2-1 14 ctaaatcatt TGGCTTTTTGATTGA ttgtacagga 28 1.000000 3-1 3 ca TTAATTTTGCTTCCA agacgacagt 17 1.000000 4-1 66 ctcatgtctt TTGGGTTTGTCTTCA atacggcagc 80 1.000000 5-1 777 tggacagctc TCATTACTAAATTAA gatagaaaa 791 1.000000 6-1 122 ctatatcttt TAGTTCTTAATTGCA acacatagat 136 1.000000 7-1 363 tatcatccta TGGTTGTTAATTTGA ttcgttaatT 377 1.000000 8-1 715 tcagtttgta TTACTTCTTATTCAA atgtcataaa 729 1.000000 9-1 35 tttctactga TCAATATTTGATGGA aaaatatgac 49 1.000000 10-1 667 AAatctctgt TCTCTCTTACTTATA tgatgattAG 681 1.000000 sites: * * ** * * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 242 256 249 -w 1.000000 >2 14 28 21 -w 1.000000 >3 3 17 10 -w 1.000000 >4 66 80 73 -w 1.000000 >5 777 791 784 -w 1.000000 >6 122 136 129 -w 1.000000 >7 363 377 370 -w 1.000000 >8 715 729 722 -w 1.000000 >9 35 49 42 -w 1.000000 >10 667 681 674 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 5 . . . 76 0.8 7 . . . 76 0.8 8 . . . 85 1.0 12 . . . 94 1.3 15 94 . . . 1.3 non- site . . . 31 site . . . 75 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 5 . . . 10 8 7 . . . 10 8 8 . . . 12 10 12 . . . 15 13 15 15 . . . 13 site . . . 9 6 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.018125 0.198386 0.755682 0.828064 7 0.027807 0.199943 0.016568 0.755682 0.809989 8 0.027807 0.109034 0.016568 0.846591 0.968787 12 0.027807 0.018125 0.016568 0.937500 1.269688 15 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.440960 Conservedness in prob: 8.770529 Concensus sequence: TTTTTA Complete log-likelihood ratio = 85 bits Missing position information = 60 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.37 bits MOTIF J 1-1 107 tacaacgctt TCATTGCT tccgaagttt 114 1.000000 2-1 728 ccccAGGTAT TCATACTT cctattagcg 735 1.000000 3-1 748 tcaagaatag TAATAGTT aagtaaacac 755 1.000000 4-1 580 ccctgcaata TAATAGTT taattctaat 587 1.000000 5-1 335 gcttgggtga TCATACTT cctggctttA 342 1.000000 6-1 427 ttattggtag TATTCGTT tggtaaagta 434 1.000000 7-1 187 aattttttgt TGATACTT ttatgacatt 194 1.000000 8-1 688 ccactttaac TAATACTT tcaacatttt 695 1.000000 9-1 579 caaatgacat TTTTCCTT tcttctcaaa 586 1.000000 10-1 67 agtaacactt TTATAGTT caTACATGCT 74 1.000000 sites: * ** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 107 114 110 -w 1.000000 >2 728 735 731 -w 1.000000 >3 748 755 751 -w 1.000000 >4 580 587 583 -w 1.000000 >5 335 342 338 -w 1.000000 >6 427 434 430 -w 1.000000 >7 187 194 190 -w 1.000000 >8 688 695 691 -w 1.000000 >9 579 586 582 -w 1.000000 >10 67 74 70 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 3 76 . . . 0.7 4 . . . 94 1.3 6 . 47 47 . 1.0 7 . . . 85 1.0 8 . . . 94 1.3 non- site . . . 31 site . . . 68 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 3 10 . . . 7 4 . . . 15 13 6 . 6 6 . 10 7 . . . 12 10 8 . . . 15 13 site . . . 8 4 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.755080 0.018125 0.016568 0.210227 0.744138 4 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.472670 0.471114 0.028409 1.039664 7 0.027807 0.109034 0.016568 0.846591 0.968787 8 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.561653 Conservedness in prob: 8.866539 Concensus sequence: TATGTT Complete log-likelihood ratio = 87 bits Missing position information = 56 bits Log-likelihood ratio statistic = 30 bits Degrees of freedom = 18 Information per parameter = 1.68 bits seed 9 time: 6 seconds (0.10 minutes) MOTIF A 1-1 416 atgggtccag CTTTCAG attgtactaa 422 1.000000 2-1 17 aatcatttgg CTTTTTG attgattgta 23 1.000000 3-1 392 caccggcggt CTTTCGT CCGTGCGgag 398 1.000000 4-1 734 tcacatatca CTGCTGG tccttgccga 740 1.000000 5-1 56 Atttttcact CTTTCTG cgcgcgccaa 62 1.000000 6-1 560 GATATatttt CTGTCAT tttccttaac 566 1.000000 7-1 107 aggtacaatc ACTTCTT ctgaatgaga 113 1.000000 8-1 603 TTTTAgcctt ATTTCTG gggtaattaa 609 1.000000 9-1 498 attcaagtgc CTTTTTT tttttttttc 504 1.000000 10-1 348 cgtcttgaaa CTTTTTG tccttttttt 354 1.000000 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 416 422 419 -w 1.000000 >2 17 23 20 -w 1.000000 >3 392 398 395 -w 1.000000 >4 734 740 737 -w 1.000000 >5 56 62 59 -w 1.000000 >6 560 566 563 -w 1.000000 >7 107 113 110 -w 1.000000 >8 603 609 606 -w 1.000000 >9 498 504 501 -w 1.000000 >10 348 354 351 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 75 . . 1.1 2 . . . 85 1.0 3 . . . 76 0.8 4 . . . 85 1.0 5 . 56 . 39 0.8 7 . . 56 39 0.9 non- site . 19 . 31 site . 26 . 56 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 14 . . 11 2 . . . 12 10 3 . . . 10 8 4 . . . 12 10 5 . 8 . 1 8 7 . . 9 1 9 site . 1 . 5 4 Weighted motif model: POS A C G T Prob 1 0.209625 0.745398 0.016568 0.028409 1.148270 2 0.027807 0.109034 0.016568 0.846591 0.968787 3 0.027807 0.018125 0.198386 0.755682 0.828064 4 0.027807 0.109034 0.016568 0.846591 0.968787 5 0.027807 0.563580 0.016568 0.392045 0.819633 7 0.027807 0.018125 0.562023 0.392045 0.882489 Conservedness in bits: 5.616029 Conservedness in prob: 9.175911 Concensus sequence: CTTTCG Complete log-likelihood ratio = 74 bits Missing position information = 50 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.34 bits MOTIF B 1-1 303 ttgaaatgga AGAAGAC gttttggtta 309 1.000000 2-1 35 ttgattgtac AGGAAAA tatacatcgc 41 1.000000 3-1 151 ttcagatcac AGCAATA taggactAGA 157 1.000000 4-1 441 actgctgcta CGGAAAA ccaacctaaa 447 1.000000 5-1 453 attccgggga AGAACAA ggaagggcgg 459 1.000000 6-1 270 cCATGGAGac ATCAAAA attgaaaatc 276 1.000000 7-1 335 agaaataagg CTAAAAA actaatcgca 341 1.000000 8-1 508 ggttatgaag AGGAAAA attggcagta 514 1.000000 9-1 630 ttcttttttt ATTAAAA aacagcatgg 636 1.000000 10-1 454 aagcgcgagg AGGAAAA gaaatgacag 460 1.000000 sites: ** **** 5 (10 sites in 10 sequences) Conservedness in sites: >1 303 309 306 -w 1.000000 >2 35 41 38 -w 1.000000 >3 151 157 154 -w 1.000000 >4 441 447 444 -w 1.000000 >5 453 459 456 -w 1.000000 >6 270 276 273 -w 1.000000 >7 335 341 338 -w 1.000000 >8 508 514 511 -w 1.000000 >9 630 636 633 -w 1.000000 >10 454 460 457 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.8 2 . . 65 . 1.0 4 94 . . . 1.3 5 76 . . . 0.7 6 85 . . . 1.0 7 85 . . . 1.0 non- site 30 . . . site 73 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 8 2 . . 12 . 10 4 15 . . . 13 5 10 . . . 7 6 12 . . . 10 7 12 . . . 10 site 9 . . . 6 Weighted motif model: POS A C G T Prob 1 0.755080 0.199943 0.016568 0.028409 0.829612 2 0.027807 0.018125 0.652932 0.301136 1.027066 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.755080 0.109034 0.107477 0.028409 0.709286 6 0.845989 0.018125 0.016568 0.119318 0.955898 7 0.845989 0.109034 0.016568 0.028409 0.991122 Conservedness in bits: 5.807727 Conservedness in prob: 8.998728 Concensus sequence: AGAAAA Complete log-likelihood ratio = 76 bits Missing position information = 56 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.09 bits MOTIF C 1-1 439 ctaatcactt CCGAGCG attaatacat 445 1.000000 2-1 508 cacttacccc ACGTTCG gtccactgtg 514 1.000000 3-1 399 ggtCTTTCGT CCGTGCG gagatatctg 405 1.000000 4-1 489 agaaaatcac ACGAGCG cccggacgat 495 1.000000 5-1 584 aggcattcac CCGTGTG acgaatcgca 590 1.000000 6-1 604 ggtccaaaaa GCGCTCG gacaactgtt 610 1.000000 7-1 508 TTtcaggaac GCGACCG gtgaagacga 514 1.000000 8-1 418 ctcgtcttca CCGGTCG cgttcctgaa 424 1.000000 9-1 346 gaaatggagt CCGTGCG agttttgtta 352 1.000000 10-1 757 gaagatcttt CGGTTCG aagacattcc 763 1.000000 sites: **** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 439 445 442 -w 1.000000 >2 508 514 511 -w 1.000000 >3 399 405 402 -w 1.000000 >4 489 495 492 -w 1.000000 >5 584 590 587 -w 1.000000 >6 604 610 607 -w 1.000000 >7 508 514 511 -w 1.000000 >8 418 424 421 -w 1.000000 >9 346 352 349 -w 1.000000 >10 757 763 760 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 56 . . 0.7 2 . 84 . . 1.5 3 . . 93 . 1.9 4 . . . 48 0.1 6 . 84 . . 1.4 7 . . 93 . 1.9 non- site . 19 18 . site . 41 40 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 8 . . 7 2 . 17 . . 15 3 . . 22 . 19 4 . . . 3 1 6 . 17 . . 14 7 . . 22 . 19 site . 4 5 . 6 Weighted motif model: POS A C G T Prob 1 0.209625 0.563580 0.198386 0.028409 0.656611 2 0.027807 0.836307 0.107477 0.028409 1.453580 3 0.027807 0.018125 0.925659 0.028409 1.913088 4 0.300534 0.109034 0.107477 0.482955 0.118851 6 0.027807 0.836307 0.016568 0.119318 1.410690 7 0.027807 0.018125 0.925659 0.028409 1.913088 Conservedness in bits: 7.465908 Conservedness in prob: 10.953386 Concensus sequence: CCGTCG Complete log-likelihood ratio = 96 bits Missing position information = 66 bits Log-likelihood ratio statistic = 29 bits Degrees of freedom = 18 Information per parameter = 1.66 bits MOTIF D 1-1 344 tctgttaact TCTTTGTTTCT ttgttGAAGA 354 1.000000 2-1 696 gtgaggcaac ACCTTTGTTAC cacattgaca 706 1.000000 3-1 206 aactggcaac TACTTTGCATC aaactccaat 216 1.000000 4-1 198 tgggcaagtg TCTTTTTATGT atcgtggaat 208 1.000000 5-1 558 aaacacggct TAATAATATGC ctatcaggca 568 1.000000 6-1 544 gagcgaaggc TCATTAGATAT attttCTGTC 554 1.000000 7-1 489 ggcgcgaggc ACATCTGCGTT tcaggaacGC 499 1.000000 8-1 234 tatccatatc TAATCTTACTT atatgttgtg 244 1.000000 9-1 407 ttttgtggaa AAATTCATCGT gAGAGAAaat 417 1.000000 10-1 22 tctactcata ACTTTAGCATC acaaaatacg 32 1.000000 sites: ** ** * * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 344 354 349 -w 1.000000 >2 696 706 701 -w 1.000000 >3 206 216 211 -w 1.000000 >4 198 208 203 -w 1.000000 >5 558 568 563 -w 1.000000 >6 544 554 549 -w 1.000000 >7 489 499 494 -w 1.000000 >8 234 244 239 -w 1.000000 >9 407 417 412 -w 1.000000 >10 22 32 27 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 39 . . 57 0.5 2 39 56 . . 0.8 4 . . . 94 1.3 5 . . . 66 0.5 7 . . 47 39 0.5 11 . 38 . 57 0.7 non- site . . . 31 site . . . 55 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 1 . . 5 5 2 1 8 . . 8 4 . . . 15 13 5 . . . 7 5 7 . . 6 1 5 11 . 4 . 5 7 site . . . 4 2 Weighted motif model: POS A C G T Prob 1 0.391443 0.018125 0.016568 0.573864 0.522474 2 0.391443 0.563580 0.016568 0.028409 0.828585 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.118716 0.199943 0.016568 0.664773 0.505347 7 0.118716 0.018125 0.471114 0.392045 0.548962 11 0.027807 0.381761 0.016568 0.573864 0.707463 Conservedness in bits: 4.382519 Conservedness in prob: 7.357297 Concensus sequence: TCTTGC Complete log-likelihood ratio = 58 bits Missing position information = 43 bits Log-likelihood ratio statistic = 14 bits Degrees of freedom = 18 Information per parameter = 0.808 bits MOTIF E 1-1 478 ttaaatacct TTTTTA atacgtatga 483 1.000000 2-1 649 ggcaGTAAAA TTTTTA ctgaaacgta 654 1.000000 3-1 316 gcaatttctt TTTCTA ttagtagcta 321 1.000000 4-1 695 agctcataac TTTTTT ttttgaacct 700 1.000000 5-1 259 aatttttttt TTTTTA aatttcaCTT 264 1.000000 6-1 173 tttatgctat TTTTTA aatttggagt 178 1.000000 7-1 644 agagaaggtt TTTTTA ggctaagata 649 1.000000 8-1 592 tgcgattagt TTTTTA gccttATTTC 597 1.000000 9-1 705 ctccaagtat TTTTTA acgtatattg 710 1.000000 10-1 234 tgactaccat TTTGTT attgtacgtg 239 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 478 483 480 -w 1.000000 >2 649 654 651 -w 1.000000 >3 316 321 318 -w 1.000000 >4 695 700 697 -w 1.000000 >5 259 264 261 -w 1.000000 >6 173 178 175 -w 1.000000 >7 644 649 646 -w 1.000000 >8 592 597 594 -w 1.000000 >9 705 710 707 -w 1.000000 >10 234 239 236 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 3 . . . 94 1.3 4 . . . 76 0.7 5 . . . 94 1.3 6 76 . . . 0.7 non- site . . . 31 site . . . 83 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 3 . . . 15 13 4 . . . 10 7 5 . . . 15 13 6 10 . . . 7 site . . . 12 9 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.109034 0.107477 0.755682 0.689662 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.755080 0.018125 0.016568 0.210227 0.744138 Conservedness in bits: 6.512552 Conservedness in prob: 8.917459 Concensus sequence: TTTTTA Complete log-likelihood ratio = 86 bits Missing position information = 56 bits Log-likelihood ratio statistic = 29 bits Degrees of freedom = 18 Information per parameter = 1.65 bits MOTIF F 1-1 367 gttGAAGAAg AACTGGCA aaatgttggt 374 1.000000 2-1 554 ctattttaac ATGTGGAA ttcttgaaag 561 1.000000 3-1 527 gatggggagc AAATGGCA ttatactcct 534 1.000000 4-1 302 aacctcctcc AGATGGAA tcccttccat 309 1.000000 5-1 764 gcaagctaaa ATTTGGAC agctctcatt 771 1.000000 6-1 296 ctatggaaag ATATGGAC ggtagcaaca 303 1.000000 7-1 707 ttagatatgg ATATGTAT atggtggtaa 714 1.000000 8-1 201 taatcatatt ACATGGCA ttaccaccat 208 1.000000 9-1 460 actaccgtag ACATGGAA tatctgccat 467 1.000000 10-1 417 tttgtactga ATTTGGAC aattcagatt 424 1.000000 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 367 374 370 -w 1.000000 >2 554 561 557 -w 1.000000 >3 527 534 530 -w 1.000000 >4 302 309 305 -w 1.000000 >5 764 771 767 -w 1.000000 >6 296 303 299 -w 1.000000 >7 707 714 710 -w 1.000000 >8 201 208 204 -w 1.000000 >9 460 467 463 -w 1.000000 >10 417 424 420 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 4 . . . 94 1.3 5 . . 93 . 1.9 6 . . 83 . 1.5 7 66 29 . . 0.7 8 57 29 . . 0.5 non- site 30 . 18 . site 38 . 31 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 4 . . . 15 13 5 . . 22 . 19 6 . . 18 . 15 7 7 2 . . 7 8 5 2 . . 5 site 1 . 3 . 1 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.018125 0.925659 0.028409 1.913088 6 0.027807 0.018125 0.834750 0.119318 1.507995 7 0.664170 0.290852 0.016568 0.028409 0.745810 8 0.573261 0.290852 0.016568 0.119318 0.454921 Conservedness in bits: 7.186246 Conservedness in prob: 9.764762 Concensus sequence: ATGGAA Complete log-likelihood ratio = 93 bits Missing position information = 64 bits Log-likelihood ratio statistic = 29 bits Degrees of freedom = 18 Information per parameter = 1.63 bits MOTIF G 1-1 503 actctaagta GTAAAA gtattatgca 508 1.000000 2-1 643 cacataggca GTAAAA TTTTTActga 648 1.000000 3-1 778 gattaacata ATAAAA aaaataattC 783 1.000000 4-1 758 cgaccagcgt ATACAA tctcgatagt 763 1.000000 5-1 41 atattccact ATAAAA tttttcactC 46 1.000000 6-1 388 gcgcttcagt GAAAAA atcataagga 393 1.000000 7-1 795 tgaaaattca ATATAA 800 1.000000 8-1 747 aaaagtatca ACAAAA aattgttaat 752 1.000000 9-1 164 tgtaaagcgg AAAAAA agttatcacc 169 1.000000 10-1 500 AAGataggaa AAAAAA aaagctttca 505 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 503 508 505 -w 1.000000 >2 643 648 645 -w 1.000000 >3 778 783 780 -w 1.000000 >4 758 763 760 -w 1.000000 >5 41 46 43 -w 1.000000 >6 388 393 390 -w 1.000000 >7 795 800 797 -w 1.000000 >8 747 752 749 -w 1.000000 >9 164 169 166 -w 1.000000 >10 500 505 502 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 66 . 29 . 0.8 2 . . . 57 0.3 3 94 . . . 1.3 4 76 . . . 0.7 5 94 . . . 1.3 6 94 . . . 1.3 non- site 30 . . . site 80 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 7 . 2 . 8 2 . . . 5 3 3 15 . . . 13 4 10 . . . 7 5 15 . . . 13 6 15 . . . 13 site 11 . . . 8 Weighted motif model: POS A C G T Prob 1 0.664170 0.018125 0.289295 0.028409 0.774819 2 0.300534 0.109034 0.016568 0.573864 0.343303 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.755080 0.109034 0.016568 0.119318 0.666396 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 5.668750 Conservedness in prob: 8.143998 Concensus sequence: ATAAAA Complete log-likelihood ratio = 75 bits Missing position information = 52 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.23 bits MOTIF H 1-1 360 TTTCTttgtt GAAGAA gAACTGGCAa 365 1.000000 2-1 763 GAGtgcaaaa AGAGAA aataaaagta 768 1.000000 3-1 165 ATAtaggact AGAAAA tatcaggtag 170 1.000000 4-1 124 ctgccatggc AAAGAA tgctttccat 129 1.000000 5-1 123 agttcgtaag AGAGAA gagatgaagt 128 1.000000 6-1 772 caacatgata AAAAAA aacagttgaa 777 1.000000 7-1 766 cgtccatcca AAAAAA aagtaagaat 771 1.000000 8-1 287 cttagcctaa AAAAAC cttctctttg 292 1.000000 9-1 419 ATTCATCGTg AGAGAA aatacgagtc 424 1.000000 10-1 573 ttttcaagtt AGACAA ggacaaaatc 578 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 360 365 362 -w 1.000000 >2 763 768 765 -w 1.000000 >3 165 170 167 -w 1.000000 >4 124 129 126 -w 1.000000 >5 123 128 125 -w 1.000000 >6 772 777 774 -w 1.000000 >7 766 771 768 -w 1.000000 >8 287 292 289 -w 1.000000 >9 419 424 421 -w 1.000000 >10 573 578 575 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 2 48 . 47 . 0.8 3 94 . . . 1.3 4 39 . 47 . 0.6 5 94 . . . 1.3 6 85 . . . 1.0 non- site 30 . . . site 78 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 2 3 . 6 . 8 3 15 . . . 13 4 1 . 6 . 6 5 15 . . . 13 6 12 . . . 10 site 11 . . . 10 Weighted motif model: POS A C G T Prob 1 0.845989 0.018125 0.107477 0.028409 0.998787 2 0.482352 0.018125 0.471114 0.028409 0.801493 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.391443 0.109034 0.471114 0.028409 0.591583 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.845989 0.109034 0.016568 0.028409 0.991122 Conservedness in bits: 5.972474 Conservedness in prob: 8.905603 Concensus sequence: AGAGAA Complete log-likelihood ratio = 79 bits Missing position information = 59 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.11 bits MOTIF I 1-1 66 tgaacaagaa CAAGAAG ttaatcaaga 72 1.000000 2-1 749 attagcggaa TCAGGAG tgcaaaaAGA 755 1.000000 3-1 588 tatacaacat TCTGGAG agctattgtt 594 1.000000 4-1 325 tccatagaga GAAGGAG caagcaactg 331 1.000000 5-1 692 gcgtataaaa CCGGGAG aatcaagaca 698 1.000000 6-1 261 tctgtaccac CATGGAG acATCAAAAa 267 1.000000 7-1 530 gacgaggacg CACGGAG gagagtcttc 536 1.000000 8-1 783 actttaacgt CAAGGAG aaaaaactat 789 1.000000 9-1 86 agtaaactat TAGGGAG ccgccggtac 92 1.000000 10-1 486 ttccgatgga CAAGAAG ataggaaAAA 492 1.000000 sites: ** **** 5 (10 sites in 10 sequences) Conservedness in sites: >1 66 72 69 -w 1.000000 >2 749 755 752 -w 1.000000 >3 588 594 591 -w 1.000000 >4 325 331 328 -w 1.000000 >5 692 698 695 -w 1.000000 >6 261 267 264 -w 1.000000 >7 530 536 533 -w 1.000000 >8 783 789 786 -w 1.000000 >9 86 92 89 -w 1.000000 >10 486 492 489 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 56 . . 0.7 2 66 29 . . 0.7 4 . . 93 . 1.9 5 . . 74 . 1.2 6 94 . . . 1.3 7 . . 93 . 1.9 non- site . . 18 . site . . 48 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 8 . . 7 2 7 2 . . 7 4 . . 22 . 19 5 . . 15 . 12 6 15 . . . 13 7 . . 22 . 19 site . . 7 . 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.563580 0.107477 0.301136 0.650708 2 0.664170 0.290852 0.016568 0.028409 0.745810 4 0.027807 0.018125 0.925659 0.028409 1.913088 5 0.209625 0.018125 0.743841 0.028409 1.234055 6 0.936898 0.018125 0.016568 0.028409 1.294744 7 0.027807 0.018125 0.925659 0.028409 1.913088 Conservedness in bits: 7.751492 Conservedness in prob: 10.950895 Concensus sequence: CAGGAG Complete log-likelihood ratio = 100 bits Missing position information = 74 bits Log-likelihood ratio statistic = 26 bits Degrees of freedom = 18 Information per parameter = 1.49 bits MOTIF J 1-1 623 tttttctttc CTTTCT cagcgatgtt 628 1.000000 2-1 266 gctgtaaaaa CTTTAT cacacttatc 271 1.000000 3-1 793 Aaaaataatt CTTTCA ta 798 1.000000 4-1 35 ctcgaagatg CTTTCA gagatggtgc 40 1.000000 5-1 272 TTAaatttca CTTTCT aaagtcccag 277 1.000000 6-1 463 aatttttccc CTTTAT tttgttcata 468 1.000000 7-1 426 aatttttcct CTTCAT aaccataaaa 431 1.000000 8-1 107 tttagaagta CTTTCA ctttgtaact 112 1.000000 9-1 436 atacgagtcc ATTTCT ccagtgaaac 441 1.000000 10-1 182 tcttgatatg CTTTCA accgctgcgt 187 1.000000 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 623 628 625 -w 1.000000 >2 266 271 268 -w 1.000000 >3 793 798 795 -w 1.000000 >4 35 40 37 -w 1.000000 >5 272 277 274 -w 1.000000 >6 463 468 465 -w 1.000000 >7 426 431 428 -w 1.000000 >8 107 112 109 -w 1.000000 >9 436 441 438 -w 1.000000 >10 182 187 184 -w 1.000000 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.4 2 . . . 94 1.3 3 . . . 94 1.3 4 . . . 85 1.0 5 . 65 . . 1.0 6 39 . . 57 0.5 non- site . 19 . 31 site . 28 . 58 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 14 2 . . . 15 13 3 . . . 15 13 4 . . . 12 10 5 . 11 . . 10 6 1 . . 5 5 site . 1 . 5 5 Weighted motif model: POS A C G T Prob 1 0.118716 0.836307 0.016568 0.028409 1.412247 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.109034 0.016568 0.846591 0.968787 5 0.300534 0.654489 0.016568 0.028409 0.959138 6 0.391443 0.018125 0.016568 0.573864 0.522474 Conservedness in bits: 6.402022 Conservedness in prob: 9.268017 Concensus sequence: CTTTCT Complete log-likelihood ratio = 84 bits Missing position information = 65 bits Log-likelihood ratio statistic = 18 bits Degrees of freedom = 18 Information per parameter = 1.02 bits seed 10 time: 6 seconds (0.10 minutes)