MOTIF A 1-1 774 atataggtat TCCATGCG caaatagatt 781 0.166205 2-1 465 cgttgcctca TCAATGCG agatccgttt 472 1.634349 3-1 398 cggtctttcg TCCGTGCG gagatatctg 405 1.385042 4-1 741 tcactgctgg TCCTTGCC gaccagcgta 748 0.387812 5-1 111 tGAGAATATt TCAGTTCG taagagagaa 118 0.304709 6-1 338 gccgcggagt TCATTTCG ttacttttga 345 0.415512 7-1 750 ttattaaact TCTTTGCG tccatccaaa 757 2.354571 8-1 398 aagactctcc TCCGTGCG tcctcgtctt 405 2.354571 9-1 345 ggaaatggag TCCGTGCG aGTTTTGTTa 352 0.692521 10-1 756 AGAAGATctt TCGGTTCG aagacattcc 763 0.304709 sites: ** **** 5 (10 sites in 10 sequences) Conservedness in sites: >1 774 781 777 -w 0.166205 >2 465 472 468 -w 1.634349 >3 398 405 401 -w 1.385042 >4 741 748 744 -w 0.387812 >5 111 118 114 -w 0.304709 >6 338 345 341 -w 0.415512 >7 750 757 753 -w 2.354571 >8 398 405 401 -w 2.354571 >9 345 352 348 -w 0.692521 >10 756 763 759 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . 93 . . 1.8 5 . . . 94 1.3 6 . . 65 . 1.0 7 . 93 . . 1.8 8 . . 83 . 1.5 non- site . 19 18 31 site . 35 26 38 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . 21 . . 18 5 . . . 15 13 6 . . 12 . 10 7 . 21 . . 18 8 . . 18 . 15 site . 3 1 1 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.927216 0.016568 0.028409 1.804236 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.018125 0.832484 0.121585 1.499907 7 0.027807 0.927216 0.016568 0.028409 1.804236 8 0.027807 0.053381 0.890403 0.028409 1.741768 Conservedness in bits: 9.389523 Conservedness in prob: 12.084810 Concensus sequence: TCTGCG Complete log-likelihood ratio = 110 bits Missing position information = 82 bits Log-likelihood ratio statistic = 28 bits Degrees of freedom = 18 Information per parameter = 1.58 bits MOTIF B 1-1 597 tccgattctt ACTCCATATC atgccatTTT 606 0.166205 2-1 579 aagaatgaaa TCGCCATGCC aagccatcac 588 1.634349 3-1 505 agttaagccc TTCCCATCTC aagatgggga 514 1.385042 4-1 133 caaagaatgc TTTCCATGAC gatcatcgta 142 0.387812 5-1 484 ttctccctca TTGTCATAGC aaggtcattt 493 0.304709 6-1 761 atgcagagca TCAACATGAT aaaAAAAAAC 770 0.415512 7-1 425 CAATTTttcc TCTTCATAAC cataaaagct 434 2.354571 8-1 224 accatataca TATCCATATC taatcttact 233 2.354571 9-1 684 caaaaagatt TGTTCATTTC actccaagta 693 0.692521 10-1 14 catttttttc TACTCATAAC tttagcatca 23 0.304709 sites: * **** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 597 606 601 -w 0.166205 >2 579 588 583 -w 1.634349 >3 505 514 509 -w 1.385042 >4 133 142 137 -w 0.387812 >5 484 493 488 -w 0.304709 >6 761 770 765 -w 0.415512 >7 425 434 429 -w 2.354571 >8 224 233 228 -w 2.354571 >9 684 693 688 -w 0.692521 >10 14 23 18 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 0.9 4 . 47 . 39 0.5 5 . 93 . . 1.8 6 94 . . . 1.3 7 . . . 94 1.3 10 . 84 . . 1.4 non- site . 19 . 31 site . 40 . 40 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 9 4 . 6 . 1 5 5 . 21 . . 18 6 15 . . . 13 7 . . . 15 13 10 . 17 . . 14 site . 4 . 1 4 Weighted motif model: POS A C G T Prob 1 0.042916 0.018125 0.016568 0.922390 1.198717 4 0.065581 0.557032 0.016568 0.360819 0.697506 5 0.027807 0.927216 0.016568 0.028409 1.804236 6 0.936898 0.018125 0.016568 0.028409 1.294744 7 0.027807 0.018125 0.016568 0.937500 1.269688 10 0.027807 0.889442 0.016568 0.066183 1.617179 Conservedness in bits: 7.882070 Conservedness in prob: 10.618546 Concensus sequence: TCCATC Complete log-likelihood ratio = 91 bits Missing position information = 68 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.25 bits MOTIF C 1-1 462 acatatctcc ATCTTT ttaaatacct 467 0.166205 2-1 707 cctttgttac CACATT gacaACCCCA 712 1.634349 3-1 240 atgcggtaga ATCTTT tcacaaaagg 245 1.385042 4-1 692 Aaaagctcat AACTTT tttttttgaa 697 0.387812 5-1 354 ctggctttag ATATTT gaaacttaac 359 0.304709 6-1 116 Tgcactctat ATCTTT tagttcttaa 121 0.415512 7-1 693 acatataagt AAGATT agatatggat 698 2.354571 8-1 473 ccgaacaata AAGATT ctacaatact 478 2.354571 9-1 11 tagctctatg TACATT gccaaggttt 16 0.692521 10-1 80 tagttcatac ATGCTT caactactta 85 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 462 467 464 -w 0.166205 >2 707 712 709 -w 1.634349 >3 240 245 242 -w 1.385042 >4 692 697 694 -w 0.387812 >5 354 359 356 -w 0.304709 >6 116 121 118 -w 0.415512 >7 693 698 695 -w 2.354571 >8 473 478 475 -w 2.354571 >9 11 16 13 -w 0.692521 >10 80 85 82 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.7 2 48 . . 48 0.5 3 . 56 29 . 0.8 4 39 . . 48 0.3 5 . . . 94 1.3 6 . . . 94 1.3 non- site . . . 31 site . . . 51 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 7 2 3 . . 3 5 3 . 8 2 . 8 4 1 . . 3 3 5 . . . 15 13 6 . . . 15 13 site . . . 4 2 Weighted motif model: POS A C G T Prob 1 0.725364 0.166702 0.016568 0.091366 0.641176 2 0.702700 0.018125 0.016568 0.262607 0.657296 3 0.055508 0.443710 0.472373 0.028409 0.926196 4 0.667444 0.045826 0.016568 0.270162 0.540078 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 5.304121 Conservedness in prob: 8.115366 Concensus sequence: AAGATT Complete log-likelihood ratio = 56 bits Missing position information = 56 bits Log-likelihood ratio statistic = 0 bits Degrees of freedom = 18 Information per parameter = -0.0323 bits MOTIF D 1-1 185 aagtTCCCAA CCCCAGT ttctcacaac 191 0.166205 2-1 175 aAACAACCGc CGGCAGC ttagtatata 181 1.634349 3-1 21 gcttccaaga CGACAGT aatatgtctc 27 1.385042 4-1 84 gtcttcaata CGGCAGC cgttgtcttg 90 0.387812 5-1 657 gaaaagacta CGGCAGT aaagaattgc 663 0.304709 6-1 620 ggacaactgt TGACCGT gatccgaagg 626 0.415512 7-1 569 gtcgcccgct CGGCGGC ttctaatccg 575 2.354571 8-1 371 gccgagcggg CGACAGC cctccgacgg 377 2.354571 9-1 616 gcgcctgtaa CTGCTTC tttttttatt 622 0.692521 10-1 186 gatatgcttt CAACCGC tgcgttttgg 192 0.304709 sites: **** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 185 191 188 -w 0.166205 >2 175 181 178 -w 1.634349 >3 21 27 24 -w 1.385042 >4 84 90 87 -w 0.387812 >5 657 663 660 -w 0.304709 >6 620 626 623 -w 0.415512 >7 569 575 572 -w 2.354571 >8 371 377 374 -w 2.354571 >9 616 622 619 -w 0.692521 >10 186 192 189 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.4 2 . . 65 . 0.8 3 39 . 47 . 0.6 4 . 93 . . 1.8 6 . . 83 . 1.5 7 . 56 . 39 0.8 non- site . 19 18 . site . 45 35 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 14 2 . . 12 . 8 3 1 . 6 . 6 4 . 21 . . 18 6 . . 18 . 15 7 . 8 . 1 8 site . 5 3 . 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.889442 0.016568 0.066183 1.617179 2 0.055508 0.033235 0.819892 0.091366 1.394102 3 0.433246 0.033235 0.505110 0.028409 0.776269 4 0.027807 0.927216 0.016568 0.028409 1.804236 6 0.027807 0.018125 0.862703 0.091366 1.614002 7 0.027807 0.720719 0.016568 0.234906 1.085938 Conservedness in bits: 8.291726 Conservedness in prob: 12.111928 Concensus sequence: CGGCGC Complete log-likelihood ratio = 83 bits Missing position information = 71 bits Log-likelihood ratio statistic = 11 bits Degrees of freedom = 18 Information per parameter = 0.621 bits MOTIF E 1-1 415 catgggtcca GCTTTCAG attgtactaa 422 0.166205 2-1 16 aaatcatttg GCTTTTTG attgattgta 23 1.634349 3-1 113 aatccaagga GGTTTACG gaccagggga 120 1.385042 4-1 527 aatggcgcaa GTTTTCCG ctttgtaata 534 0.387812 5-1 639 tagaaaccga GCTTTCAG gaaaagacta 646 0.304709 6-1 734 aggtcggaaa TATTTATG ggcattatta 741 0.415512 7-1 392 ttaatttgaa GGTTTGTG gggccaggtt 399 2.354571 8-1 162 ATTcttactt TTTTTTTG gatggacgca 169 2.354571 9-1 354 gTCCGTGCGa GTTTTGTT aggatgactG 361 0.692521 10-1 115 tgtatgataa TGTTTTCA atgtaagagA 122 0.304709 sites: * *** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 415 422 418 -w 0.166205 >2 16 23 19 -w 1.634349 >3 113 120 116 -w 1.385042 >4 527 534 530 -w 0.387812 >5 639 646 642 -w 0.304709 >6 734 741 737 -w 0.415512 >7 392 399 395 -w 2.354571 >8 162 169 165 -w 2.354571 >9 354 361 357 -w 0.692521 >10 115 122 118 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 65 . 1.0 3 . . . 94 1.3 4 . . . 94 1.3 5 . . . 94 1.3 7 . 29 . 48 0.3 8 . . 74 . 1.1 non- site . . 18 31 site . . 25 65 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 12 . 10 3 . . . 15 13 4 . . . 15 13 5 . . . 15 13 7 . 2 . 3 3 8 . . 15 . 11 site . . 1 7 6 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.646133 0.307936 1.014346 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.018125 0.016568 0.937500 1.269688 7 0.070617 0.206994 0.016568 0.705820 0.634191 8 0.055508 0.018125 0.835002 0.091366 1.472081 Conservedness in bits: 6.929682 Conservedness in prob: 9.952104 Concensus sequence: GTTTTG Complete log-likelihood ratio = 77 bits Missing position information = 68 bits Log-likelihood ratio statistic = 9 bits Degrees of freedom = 18 Information per parameter = 0.55 bits MOTIF F 1-1 685 agcatgttga GTGAATTT cacagatcga 692 0.166205 2-1 37 gattgtacag GAAAATAT acatcgcagg 44 1.634349 3-1 166 tataggacta GAAAATAT caggtagccg 173 1.385042 4-1 592 atagtttaat TCTAATAT taataatatc 599 0.387812 5-1 102 taggtaacat GAGAATAT tTCAGTTCGt 109 0.304709 6-1 99 tatccttctt GAAAATAT gcactctatA 106 0.415512 7-1 413 ccaggttact GCCAATTT ttccTCTTCA 420 2.354571 8-1 664 tatataaatg GAAAAGCT gcataaccac 671 2.354571 9-1 759 gcaatacaaa GAGAATTT tattcgaacg 766 0.692521 10-1 745 atACCCCAta GAGAAGAT cttTCGGTTC 752 0.304709 sites: ** *** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 685 692 688 -w 0.166205 >2 37 44 40 -w 1.634349 >3 166 173 169 -w 1.385042 >4 592 599 595 -w 0.387812 >5 102 109 105 -w 0.304709 >6 99 106 102 -w 0.415512 >7 413 420 416 -w 2.354571 >8 664 671 667 -w 2.354571 >9 759 766 762 -w 0.692521 >10 745 752 748 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 83 . 1.5 2 66 . . . 0.5 4 94 . . . 1.3 5 94 . . . 1.3 6 . . . 76 0.8 8 . . . 94 1.3 non- site 30 . . . site 45 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 18 . 15 2 7 . . . 5 4 15 . . . 13 5 15 . . . 13 6 . . . 10 8 8 . . . 15 13 site 3 . . . 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.890403 0.063665 1.732697 2 0.672481 0.267432 0.016568 0.043519 0.696527 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.027807 0.018125 0.258321 0.695747 0.774485 8 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.062886 Conservedness in prob: 9.394660 Concensus sequence: GAAATT Complete log-likelihood ratio = 85 bits Missing position information = 64 bits Log-likelihood ratio statistic = 21 bits Degrees of freedom = 18 Information per parameter = 1.21 bits MOTIF G 1-1 179 gctggtaagt TCCCAA CCCCAGTttc 184 0.166205 2-1 717 CACATTgaca ACCCCA ggtattcata 722 1.634349 3-1 219 tttgcatcaa ACTCCA attaaatgcg 224 1.385042 4-1 267 gcctctactt ACTCCA tcgacaattc 272 0.387812 5-1 66 CTTtctgcgc GCGCCA atgtccccgc 71 0.304709 6-1 575 attttcctta ACCCAA aaataaggga 580 0.415512 7-1 320 ctgattaatt ACCCCA gaaataaggc 325 2.354571 8-1 267 aatgtaaaga GCCCCA ttatcttagc 272 2.354571 9-1 371 Taggatgact GCCCCA cacatttcct 376 0.692521 10-1 737 tctaaagcat ACCCCA taGAGAAGAT 742 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 179 184 181 -w 0.166205 >2 717 722 719 -w 1.634349 >3 219 224 221 -w 1.385042 >4 267 272 269 -w 0.387812 >5 66 71 68 -w 0.304709 >6 575 580 577 -w 0.415512 >7 320 325 322 -w 2.354571 >8 267 272 269 -w 2.354571 >9 371 376 373 -w 0.692521 >10 737 742 739 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 57 . 29 . 0.5 2 . 93 . . 1.8 3 . 65 . . 0.8 4 . 93 . . 1.8 5 . 75 . . 1.1 6 94 . . . 1.3 non- site . 19 . . site . 58 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 5 . 2 . 5 2 . 21 . . 18 3 . 11 . . 8 4 . 21 . . 18 5 . 14 . . 11 6 15 . . . 13 site . 9 . . 7 Weighted motif model: POS A C G T Prob 1 0.617079 0.018125 0.321277 0.043519 0.701098 2 0.027807 0.927216 0.016568 0.028409 1.804236 3 0.027807 0.738347 0.044269 0.189578 1.071328 4 0.027807 0.927216 0.016568 0.028409 1.804236 5 0.080690 0.874333 0.016568 0.028409 1.553966 6 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 8.229608 Conservedness in prob: 11.083815 Concensus sequence: ACCCCA Complete log-likelihood ratio = 91 bits Missing position information = 70 bits Log-likelihood ratio statistic = 21 bits Degrees of freedom = 18 Information per parameter = 1.2 bits MOTIF H 1-1 614 ATCatgccat TTTTCTTTCCTT tctcagcgat 625 0.166205 2-1 605 tcacacggtc TTTTATGCAATT gattgaccgc 616 1.634349 3-1 577 tattcttaaa TTATACAACATT ctggagagct 588 1.385042 4-1 615 atatcctata TTTTCTTCATTT accggcgcac 626 0.387812 5-1 47 cactataaaa TTTTTCACTCTT tctgcgcGCG 58 0.304709 6-1 164 ataacgaatt TTATGCTATTTT ttaaatttgg 175 0.415512 7-1 138 gtcattatag TTTTTTCTCCTT gacgttaaag 149 2.354571 8-1 143 ttatattgaa TTTTCAAAAATT cttacttTTT 154 2.354571 9-1 579 caaatgacat TTTTCCTTTCTT ctcaaacttt 590 0.692521 10-1 349 gtcttgaaac TTTTTGTCCTTT tttttttccg 360 0.304709 sites: **** ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 614 625 619 -w 0.166205 >2 605 616 610 -w 1.634349 >3 577 588 582 -w 1.385042 >4 615 626 620 -w 0.387812 >5 47 58 52 -w 0.304709 >6 164 175 169 -w 0.415512 >7 138 149 143 -w 2.354571 >8 143 154 148 -w 2.354571 >9 579 590 584 -w 0.692521 >10 349 360 354 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 3 . . . 76 0.7 4 . . . 94 1.3 11 . . . 94 1.3 12 . . . 94 1.3 non- site . . . 31 site . . . 96 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 3 . . . 10 7 4 . . . 15 13 11 . . . 15 13 12 . . . 15 13 site . . . 16 15 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.191494 0.018125 0.016568 0.773813 0.762847 4 0.027807 0.018125 0.016568 0.937500 1.269688 11 0.027807 0.018125 0.016568 0.937500 1.269688 12 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.111287 Conservedness in prob: 9.232942 Concensus sequence: TTTTTT Complete log-likelihood ratio = 94 bits Missing position information = 64 bits Log-likelihood ratio statistic = 29 bits Degrees of freedom = 18 Information per parameter = 1.64 bits MOTIF I 1-1 61 gaagttgaac AAGAACAA gaagttaatc 68 0.166205 2-1 166 cggtcttgca AACAACCG cCGGCAGCtt 173 1.634349 3-1 610 ttgttcaaaa AACAAACA tttcgcaggc 617 1.385042 4-1 675 ctacattcat AATAACCA aaagctcatA 682 0.387812 5-1 522 cagaaagggg TAGAATCA atctagcacg 529 0.304709 6-1 774 ACATGATaaa AAAAAACA gttgaatatt 781 0.415512 7-1 342 aggctaaaaa ACTAATCG cattatcatc 349 2.354571 8-1 551 cttcaaatta ACGAATCA aattaacaac 558 2.354571 9-1 633 tttttttatt AAAAAACA gcatggagtt 640 0.692521 10-1 501 agataggaaa AAAAAAAA gctttcaccg 508 0.304709 sites: ** ** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 61 68 64 -w 0.166205 >2 166 173 169 -w 1.634349 >3 610 617 613 -w 1.385042 >4 675 682 678 -w 0.387812 >5 522 529 525 -w 0.304709 >6 774 781 777 -w 0.415512 >7 342 349 345 -w 2.354571 >8 551 558 554 -w 2.354571 >9 633 640 636 -w 0.692521 >10 501 508 504 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 2 76 . . . 0.8 4 94 . . . 1.3 5 94 . . . 1.3 7 . 75 . . 1.1 8 76 . . . 0.8 non- site 30 . . . site 78 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 2 10 . . . 8 4 15 . . . 13 5 15 . . . 13 7 . 14 . . 11 8 10 . . . 8 site 11 . . . 9 Weighted motif model: POS A C G T Prob 1 0.909197 0.018125 0.016568 0.056110 1.169907 2 0.508794 0.446229 0.016568 0.028409 0.736581 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.936898 0.018125 0.016568 0.028409 1.294744 7 0.070617 0.884406 0.016568 0.028409 1.595845 8 0.574269 0.018125 0.379197 0.028409 0.761727 Conservedness in bits: 6.853549 Conservedness in prob: 9.170101 Concensus sequence: ACAACG Complete log-likelihood ratio = 77 bits Missing position information = 65 bits Log-likelihood ratio statistic = 11 bits Degrees of freedom = 18 Information per parameter = 0.664 bits MOTIF J 1-1 496 acgtatgact CTAAGTA gtaaaagtat 502 0.166205 2-1 429 atgcagatag ATAACAA tctatatgtt 435 1.634349 3-1 42 tgtctcctac AATACCA gtttcgctgc 48 1.385042 4-1 476 cttcttcact ATAAGAA aatcacacga 482 0.387812 5-1 779 gacagctctc ATTACTA aattaagata 785 0.304709 6-1 397 tgaaaaaatc ATAAGGA aaagttgtaa 403 0.415512 7-1 171 atagaggtat ATTAACA attttttgtt 177 2.354571 8-1 351 tgaagtacgg ATTAGAA gccgccgagc 357 2.354571 9-1 782 gaacgcatag AGTACAC acactcaaag 788 0.692521 10-1 132 Aatgtaagag ATTTCGA ttatccacaa 138 0.304709 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 496 502 499 -w 0.166205 >2 429 435 432 -w 1.634349 >3 42 48 45 -w 1.385042 >4 476 482 479 -w 0.387812 >5 779 785 782 -w 0.304709 >6 397 403 400 -w 0.415512 >7 171 177 174 -w 2.354571 >8 351 357 354 -w 2.354571 >9 782 788 785 -w 0.692521 >10 132 138 135 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 2 . . . 76 0.7 3 39 . . 57 0.5 4 85 . . . 1.0 5 . 47 38 . 0.7 7 85 . . . 1.0 non- site 30 . . . site 55 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 2 . . . 10 7 3 1 . . 5 5 4 12 . . . 10 5 . 6 4 . 7 7 12 . . . 10 site 5 . . . 2 Weighted motif model: POS A C G T Prob 1 0.921788 0.033235 0.016568 0.028409 1.225521 2 0.153720 0.018125 0.079525 0.748631 0.633135 3 0.264523 0.018125 0.016568 0.700784 0.641043 4 0.909197 0.018125 0.016568 0.056110 1.169907 5 0.241859 0.410973 0.318759 0.028409 0.505754 7 0.873941 0.081081 0.016568 0.028409 1.062824 Conservedness in bits: 5.238184 Conservedness in prob: 8.146809 Concensus sequence: ATTACA Complete log-likelihood ratio = 59 bits Missing position information = 53 bits Log-likelihood ratio statistic = 5 bits Degrees of freedom = 18 Information per parameter = 0.314 bits seed 1 time: 7 seconds (0.12 minutes) MOTIF A 1-1 633 ctttctcagc GATGTTTTGT aggaaatcac 642 0.166205 2-1 271 aaaaacttta TCACACTTAT ctcaaataca 280 1.634349 3-1 305 ttaagtaggt TGCAATTTCT TTTTCTatta 314 1.385042 4-1 213 ttatgtatcg TGGAATTTAT cctgctggtc 222 0.387812 5-1 248 gacctctgtt AAATTTTTTT TTTTTTaaat 257 0.304709 6-1 552 gctcattaga TATATTTTCT gtcattttcc 561 0.415512 7-1 177 gtatattaac AATTTTTTGT tgatactttt 186 2.354571 8-1 129 aactgagctg TCATTTATAT tgaattttca 138 2.354571 9-1 620 ctgtaactgc TTCTTTTTTT attaaaaaac 629 0.692521 10-1 61 aCGAGTAGta ACACTTTTAT agTTCATAca 70 0.304709 sites: ** *** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 633 642 637 -w 0.166205 >2 271 280 275 -w 1.634349 >3 305 314 309 -w 1.385042 >4 213 222 217 -w 0.387812 >5 248 257 252 -w 0.304709 >6 552 561 556 -w 0.415512 >7 177 186 181 -w 2.354571 >8 129 138 133 -w 2.354571 >9 620 629 624 -w 0.692521 >10 61 70 65 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 57 0.4 2 39 29 . . 0.2 6 . . . 85 1.0 7 . . . 85 0.9 8 . . . 94 1.3 10 . . . 94 1.3 non- site . . . 31 site . . . 75 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 5 4 2 1 2 . . 2 6 . . . 12 10 7 . . . 12 9 8 . . . 15 13 10 . . . 15 13 site . . . 9 6 Weighted motif model: POS A C G T Prob 1 0.297260 0.018125 0.031678 0.652937 0.539209 2 0.322443 0.408455 0.177737 0.091366 0.278639 6 0.027807 0.166702 0.016568 0.788923 0.857466 7 0.241859 0.018125 0.016568 0.723448 0.674165 8 0.027807 0.018125 0.016568 0.937500 1.269688 10 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 4.888854 Conservedness in prob: 7.814766 Concensus sequence: TCTTTT Complete log-likelihood ratio = 62 bits Missing position information = 54 bits Log-likelihood ratio statistic = 7 bits Degrees of freedom = 18 Information per parameter = 0.405 bits MOTIF B 1-1 440 taatcacttc CGAGCGA ttaatacata 446 0.166205 2-1 528 cactgtgtgc CGAACAT gctccttcac 534 1.634349 3-1 182 atcaggtagc CGCACTC aacttgtaac 188 1.385042 4-1 632 CATTTaccgg CGCACTC tcgcccgaac 638 0.387812 5-1 597 tgtgacgaat CGCACAC cgctgctctc 603 0.304709 6-1 325 gaatatagca CGAGCCG cggagttcat 331 0.415512 7-1 528 aagacgagga CGCACGG aggagagtct 534 2.354571 8-1 449 agatgtgcct CGCGCCG cactgctccg 455 2.354571 9-1 771 gaattttatt CGAACGC ATAGAGTACA 777 0.692521 10-1 52 gcaataataa CGAGTAG taACACTTTT 58 0.304709 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 440 446 443 -w 0.166205 >2 528 534 531 -w 1.634349 >3 182 188 185 -w 1.385042 >4 632 638 635 -w 0.387812 >5 597 603 600 -w 0.304709 >6 325 331 328 -w 0.415512 >7 528 534 531 -w 2.354571 >8 449 455 452 -w 2.354571 >9 771 777 774 -w 0.692521 >10 52 58 55 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 . . 93 . 1.9 3 48 47 . . 0.8 4 57 . 38 . 0.8 5 . 84 . . 1.4 7 . 38 38 . 0.4 non- site . 19 18 . site . 46 30 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 . . 22 . 19 3 3 6 . . 8 4 5 . 4 . 8 5 . 17 . . 14 7 . 4 4 . 4 site . 6 2 . 6 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.027807 0.018125 0.925659 0.028409 1.913088 3 0.319925 0.635098 0.016568 0.028409 0.926695 4 0.642262 0.018125 0.311204 0.028409 0.766611 5 0.027807 0.899515 0.016568 0.056110 1.662716 7 0.042916 0.269951 0.510147 0.176986 0.608826 Conservedness in bits: 7.682173 Conservedness in prob: 10.962353 Concensus sequence: CGCACG Complete log-likelihood ratio = 87 bits Missing position information = 62 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.37 bits MOTIF C 1-1 783 ttccatgcgc AAATAGATTACTT gcaaa 795 0.166205 2-1 231 cctcgtaatc ATTTTCTTGTATT tatcgtcttt 243 1.634349 3-1 784 cataataaaa AAAATAATTCTTT cata 796 1.385042 4-1 614 aatatcctat ATTTTCTTCATTT accggCGCAC 626 0.387812 5-1 214 gcccagttct ACATTTTTTTTTT tttggaagta 226 0.304709 6-1 478 ttttgttcat ACATTCTTAAATT gctttgcctc 490 0.415512 7-1 25 aagcgcttat AAATTTCTTAATT atgctcgggc 37 2.354571 8-1 175 TTTTggatgg ACGCAAAGAAGTT taataatcat 187 2.354571 9-1 466 gTAGACATGG AATATCTGCCATT ctacccctta 478 0.692521 10-1 706 catctgtata AAACTCCTTTCTT aatttcactc 718 0.304709 sites: * * * * ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 783 795 789 -w 0.166205 >2 231 243 237 -w 1.634349 >3 784 796 790 -w 1.385042 >4 614 626 620 -w 0.387812 >5 214 226 220 -w 0.304709 >6 478 490 484 -w 0.415512 >7 25 37 31 -w 2.354571 >8 175 187 181 -w 2.354571 >9 466 478 472 -w 0.692521 >10 706 718 712 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 3 57 . . . 0.4 5 . . . 76 0.7 8 . . . 76 0.8 12 . . . 94 1.3 13 . . . 94 1.3 non- site . . . 31 site . . . 65 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 3 5 . . . 4 5 . . . 10 7 8 . . . 10 8 12 . . . 15 13 13 . . . 15 13 site . . . 7 6 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 3 0.476057 0.018125 0.230620 0.275198 0.268964 5 0.256968 0.018125 0.016568 0.708339 0.651644 8 0.027807 0.018125 0.293576 0.660492 0.756152 12 0.027807 0.018125 0.016568 0.937500 1.269688 13 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 5.510880 Conservedness in prob: 7.683333 Concensus sequence: AATTTT Complete log-likelihood ratio = 74 bits Missing position information = 65 bits Log-likelihood ratio statistic = 9 bits Degrees of freedom = 18 Information per parameter = 0.501 bits MOTIF D 1-1 667 aacttgcctt ACTTTAA aagcatgttg 673 0.166205 2-1 708 ctttgttacc ACATTGA caaccccagg 714 1.634349 3-1 75 cacatctatt ACATTTA ctgagcataa 81 1.385042 4-1 667 aatgtctgct ACATTCA taataaccaa 673 0.387812 5-1 706 gagaatcaag ACATTCT aatgacttga 712 0.304709 6-1 454 agagggggta ATTTTTC ccctttattt 460 0.415512 7-1 101 gaactcaggt ACAATCA cttcttctga 107 2.354571 8-1 680 ctgcataacc ACTTTAA ctaatacttt 686 2.354571 9-1 81 gtattagtaa ACTATTA gggagccgcc 87 0.692521 10-1 767 cggttcgaag ACATTCC tacgcataat 773 0.304709 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 667 673 670 -w 0.166205 >2 708 714 711 -w 1.634349 >3 75 81 78 -w 1.385042 >4 667 673 670 -w 0.387812 >5 706 712 709 -w 0.304709 >6 454 460 457 -w 0.415512 >7 101 107 104 -w 2.354571 >8 680 686 683 -w 2.354571 >9 81 87 84 -w 0.692521 >10 767 773 770 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 . 84 . . 1.4 3 57 . . 39 0.5 4 . . . 76 0.7 5 . . . 94 1.3 7 66 . . . 0.5 non- site 30 . . 31 site 41 . . 40 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 . 17 . . 14 3 5 . . 1 5 4 . . . 10 7 5 . . . 15 13 7 7 . . . 5 site 2 . . 1 3 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.027807 0.889442 0.016568 0.066183 1.617179 3 0.607006 0.018125 0.016568 0.358301 0.550868 4 0.304815 0.018125 0.016568 0.660492 0.591577 5 0.027807 0.018125 0.016568 0.937500 1.269688 7 0.843722 0.083600 0.016568 0.056110 0.933905 Conservedness in bits: 6.257962 Conservedness in prob: 8.889607 Concensus sequence: ACATTA Complete log-likelihood ratio = 72 bits Missing position information = 59 bits Log-likelihood ratio statistic = 12 bits Degrees of freedom = 18 Information per parameter = 0.693 bits MOTIF E 1-1 293 gttggtaacg TTGAAATGG aagaagacgt 301 0.166205 2-1 194 agtatataaa TACACATGT acatacctct 202 1.634349 3-1 330 Tattagtagc TAAAAATGG gtcacgtgat 338 1.385042 4-1 513 gatgtctctg TTTAAATGG cgcaagtttt 521 0.387812 5-1 162 tgctcgaggt TACAGAAGG gccgcattag 170 0.304709 6-1 683 aaataatgtg TAGCTATGT tcagttagtt 691 0.415512 7-1 710 gatatggata TGTATATGG tggtaatgcc 718 2.354571 8-1 656 ttaacagata TATAAATGG aaaagctgca 664 2.354571 9-1 457 gaaactaccg TAGACATGG AATATCTGCC 465 0.692521 10-1 414 aattttgtac TGAATTTGG acaattcaga 422 0.304709 sites: * * **** 5 (10 sites in 10 sequences) Conservedness in sites: >1 293 301 297 -w 0.166205 >2 194 202 198 -w 1.634349 >3 330 338 334 -w 1.385042 >4 513 521 517 -w 0.387812 >5 162 170 166 -w 0.304709 >6 683 691 687 -w 0.415512 >7 710 718 714 -w 2.354571 >8 656 664 660 -w 2.354571 >9 457 465 461 -w 0.692521 >10 414 422 418 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 4 85 . . . 1.0 6 85 . . . 1.0 7 . . . 85 0.9 8 . . 93 . 1.9 9 . . 74 . 1.2 non- site . . 18 31 site . . 30 36 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 4 12 . . . 10 6 12 . . . 10 7 . . . 12 9 8 . . 22 . 19 9 . . 15 . 12 site . . 2 1 3 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.899124 0.055899 0.016568 0.028409 1.140510 6 0.909197 0.018125 0.016568 0.056110 1.169907 7 0.055508 0.018125 0.016568 0.909799 1.145941 8 0.027807 0.018125 0.925659 0.028409 1.913088 9 0.027807 0.018125 0.739308 0.214760 1.218481 Conservedness in bits: 7.857615 Conservedness in prob: 10.618702 Concensus sequence: TAATGG Complete log-likelihood ratio = 92 bits Missing position information = 71 bits Log-likelihood ratio statistic = 21 bits Degrees of freedom = 18 Information per parameter = 1.17 bits MOTIF F 1-1 68 aacaagaaca AGAAGTTAATCA agaagttgtc 79 0.166205 2-1 425 gttcatgcag ATAGATAACAAT ctatatgttg 436 1.634349 3-1 607 ctattgttca AAAAACAAACAT ttcgcaggct 618 1.385042 4-1 476 cttcttcact ATAAGAAAATCA cacgagcgcc 487 0.387812 5-1 755 tgcatcttag CAAGCTAAAATT tggacagctc 766 0.304709 6-1 397 tgaaaaaatc ATAAGGAAAAGT tgtaaatatt 408 0.415512 7-1 769 ccatccaaaa AAAAAGTAAGAA tttttgaaaa 780 2.354571 8-1 544 cacaaacctt CAAATTAACGAA tcaaattaac 555 2.354571 9-1 778 attCGAACGC ATAGAGTACACA cactcaaagg 789 0.692521 10-1 493 ggacaagaag ATAGGAAAAAAA aaaagctttc 504 0.304709 sites: * ** ** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 68 79 73 -w 0.166205 >2 425 436 430 -w 1.634349 >3 607 618 612 -w 1.385042 >4 476 487 481 -w 0.387812 >5 755 766 760 -w 0.304709 >6 397 408 402 -w 0.415512 >7 769 780 774 -w 2.354571 >8 544 555 549 -w 2.354571 >9 778 789 783 -w 0.692521 >10 493 504 498 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.8 3 94 . . . 1.3 4 57 . 38 . 0.8 8 94 . . . 1.3 9 66 29 . . 0.7 12 57 . . 39 0.5 non- site 30 . . . site 78 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 8 3 15 . . . 13 4 5 . 4 . 8 8 15 . . . 13 9 7 2 . . 7 12 5 . . 1 5 site 11 . . . 7 Weighted motif model: POS A C G T Prob 1 0.695145 0.259878 0.016568 0.028409 0.767078 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.669962 0.018125 0.283503 0.028409 0.777557 8 0.936898 0.018125 0.016568 0.028409 1.294744 9 0.511312 0.443710 0.016568 0.028409 0.735522 12 0.596933 0.018125 0.016568 0.368374 0.543219 Conservedness in bits: 5.412865 Conservedness in prob: 7.664170 Concensus sequence: AAAACA Complete log-likelihood ratio = 71 bits Missing position information = 56 bits Log-likelihood ratio statistic = 15 bits Degrees of freedom = 18 Information per parameter = 0.836 bits MOTIF G 1-1 91 gaagttgtct AAGAAGT acaacgcttt 97 0.166205 2-1 778 aaataaaagt AAAAAGG tagggcaaca 784 1.634349 3-1 248 gaatCTTTTC ACAAAAG gtactcaacg 254 1.385042 4-1 443 tgctgctacg GAAAACC aacctaaagg 449 0.387812 5-1 377 aactcttgtc AACAAAC ttcctatgga 383 0.304709 6-1 27 gtgtaacctt GAAAAAC ggtgaaactt 33 0.415512 7-1 227 aatacaaact GAAAATG ttgaaagtat 233 2.354571 8-1 790 cgtcaaggag AAAAAAC tata 796 2.354571 9-1 323 aacaagcggg AAAAAGG tccggggaaa 329 0.692521 10-1 460 gaggaggaaa AGAAATG acagaaaaat 466 0.304709 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 91 97 94 -w 0.166205 >2 778 784 781 -w 1.634349 >3 248 254 251 -w 1.385042 >4 443 449 446 -w 0.387812 >5 377 383 380 -w 0.304709 >6 27 33 30 -w 0.415512 >7 227 233 230 -w 2.354571 >8 790 796 793 -w 2.354571 >9 323 329 326 -w 0.692521 >10 460 466 463 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 66 . 29 . 0.8 2 76 . . . 0.7 3 76 . . . 0.7 4 94 . . . 1.3 5 94 . . . 1.3 7 . 38 47 . 0.7 non- site 30 . . . site 71 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 7 . 2 . 8 2 10 . . . 7 3 10 . . . 7 4 15 . . . 13 5 15 . . . 13 7 . 4 6 . 7 site 9 . . . 7 Weighted motif model: POS A C G T Prob 1 0.649816 0.018125 0.303650 0.028409 0.769062 2 0.783284 0.144038 0.044269 0.028409 0.806382 3 0.894087 0.045826 0.031678 0.028409 1.108123 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.936898 0.018125 0.016568 0.028409 1.294744 7 0.027807 0.332907 0.595767 0.043519 1.044326 Conservedness in bits: 6.317381 Conservedness in prob: 8.929886 Concensus sequence: AAAAAG Complete log-likelihood ratio = 68 bits Missing position information = 54 bits Log-likelihood ratio statistic = 14 bits Degrees of freedom = 18 Information per parameter = 0.796 bits MOTIF H 1-1 351 acttctttgt TTCTTT gttgaagaag 356 0.166205 2-1 727 accccaggta TTCATA cttcctatta 732 1.634349 3-1 569 tgtgcacata TTCTTA aattatacaa 574 1.385042 4-1 784 tggtttcccg TTCTTT ccactcccgt 789 0.387812 5-1 115 aatatttcag TTCGTA agagagaaga 120 0.304709 6-1 125 tatcttttag TTCTTA attgcaacac 130 0.415512 7-1 427 atttttcctc TTCATA accataaaag 432 2.354571 8-1 719 tttgtattac TTCTTA ttcaaatgtc 724 2.354571 9-1 357 cgtgcgagtt TTGTTA ggatgactgc 362 0.692521 10-1 73 ACTTTTATag TTCATA catgcttcaa 78 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 351 356 353 -w 0.166205 >2 727 732 729 -w 1.634349 >3 569 574 571 -w 1.385042 >4 784 789 786 -w 0.387812 >5 115 120 117 -w 0.304709 >6 125 130 127 -w 0.415512 >7 427 432 429 -w 2.354571 >8 719 724 721 -w 2.354571 >9 357 362 359 -w 0.692521 >10 73 78 75 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 3 . 84 . . 1.5 4 . . . 57 0.4 5 . . . 94 1.3 6 76 . . . 0.7 non- site . . . 31 site . . . 63 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 3 . 17 . . 15 4 . . . 5 4 5 . . . 15 13 6 10 . . . 7 site . . . 6 4 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.864259 0.079525 0.028409 1.539134 4 0.418137 0.018125 0.044269 0.519469 0.416379 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.886533 0.018125 0.016568 0.078774 1.084406 Conservedness in bits: 6.848983 Conservedness in prob: 9.139281 Concensus sequence: TTCTTA Complete log-likelihood ratio = 80 bits Missing position information = 60 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.12 bits MOTIF I 1-1 614 atcatgccat TTTTCT ttcctttctc 619 0.166205 2-1 150 cttgctagcc TTTTCT cggtcttgca 155 1.634349 3-1 315 TGCAATTTCT TTTTCT attagtagcT 320 1.385042 4-1 698 tcataacttt TTTTTT tgaacctgaa 703 0.387812 5-1 258 AAATTTTTTT TTTTTT aaatttcact 263 0.304709 6-1 172 ttttatgcta TTTTTT aaatttggag 177 0.415512 7-1 140 cattatagtt TTTTCT ccttgacgtt 145 2.354571 8-1 163 ttcttacttt TTTTTT ggatggACGC 168 2.354571 9-1 24 attgccaagg TTTTCT actgatcaat 29 0.692521 10-1 358 ctttttgtcc TTTTTT ttttccgggg 363 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 614 619 616 -w 0.166205 >2 150 155 152 -w 1.634349 >3 315 320 317 -w 1.385042 >4 698 703 700 -w 0.387812 >5 258 263 260 -w 0.304709 >6 172 177 174 -w 0.415512 >7 140 145 142 -w 2.354571 >8 163 168 165 -w 2.354571 >9 24 29 26 -w 0.692521 >10 358 363 360 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 3 . . . 94 1.3 4 . . . 94 1.3 5 . 47 . 48 0.7 6 . . . 94 1.3 non- site . . . 31 site . . . 91 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 3 . . . 15 13 4 . . . 15 13 5 . 6 . 3 7 6 . . . 15 13 site . . . 14 13 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.584733 0.016568 0.370892 0.845828 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.194268 Conservedness in prob: 9.477106 Concensus sequence: TTTTCT Complete log-likelihood ratio = 94 bits Missing position information = 66 bits Log-likelihood ratio statistic = 27 bits Degrees of freedom = 18 Information per parameter = 1.51 bits MOTIF J 1-1 735 tcaaccatac CTGCTA ttatataatc 740 0.166205 2-1 107 tgaagagaat GTTCAC aggcgcatac 112 1.634349 3-1 242 gcggtagaat CTTTTC ACAAAAGgta 247 1.385042 4-1 562 ataccccttt CTTCTC tcccctgcaa 567 0.387812 5-1 507 gtcatttcgc CTTCTC agaaaggggt 512 0.304709 6-1 247 ttgtttacaa GTTCTC tgtaccacca 252 0.415512 7-1 264 ggttatgcag CTTTTC catttatata 269 2.354571 8-1 293 ctaaaaaaac CTTCTC tttggaactt 298 2.354571 9-1 724 tatattgaaa GTTCTC aatagcgaaa 729 0.692521 10-1 665 ttaaatctct GTTCTC tcttacttat 670 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 735 740 737 -w 0.166205 >2 107 112 109 -w 1.634349 >3 242 247 244 -w 1.385042 >4 562 567 564 -w 0.387812 >5 507 512 509 -w 0.304709 >6 247 252 249 -w 0.415512 >7 264 269 266 -w 2.354571 >8 293 298 295 -w 2.354571 >9 724 729 726 -w 0.692521 >10 665 670 667 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 56 38 . 1.1 2 . . . 94 1.3 3 . . . 85 1.0 4 . 75 . . 1.1 5 . . . 85 0.9 6 . 84 . . 1.4 non- site . 19 . 31 site . 38 . 50 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 8 4 . 11 2 . . . 15 13 3 . . . 12 10 4 . 14 . . 11 5 . . . 12 9 6 . 17 . . 14 site . 4 . 3 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.650208 0.293576 0.028409 1.116326 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.031678 0.922390 1.201468 4 0.027807 0.587251 0.016568 0.368374 0.849135 5 0.176384 0.018125 0.016568 0.788923 0.793916 6 0.042916 0.912106 0.016568 0.028409 1.723711 Conservedness in bits: 6.954244 Conservedness in prob: 9.940138 Concensus sequence: CTTCTC Complete log-likelihood ratio = 84 bits Missing position information = 66 bits Log-likelihood ratio statistic = 17 bits Degrees of freedom = 18 Information per parameter = 0.976 bits seed 2 time: 6 seconds (0.10 minutes) MOTIF A 1-1 452 agCGATTAat ACATATC tccatctttt 458 0.166205 2-1 435 atagataaca ATCTATA tgttgataat 441 1.634349 3-1 660 ttttgtagac ATATATA aacaatcagt 666 1.385042 4-1 713 ttgaacctga ATATATA tacatcacat 719 0.387812 5-1 791 tactaaatta AGATAGA aaa 797 0.304709 6-1 101 tccttcttga AAATATG cactctatat 107 0.415512 7-1 699 aagtaagatt AGATATG gatatgtata 705 2.354571 8-1 794 aaggagaaaa AACTATA 800 2.354571 9-1 4 tag CTCTATG tacattgcca 10 0.692521 10-1 148 attatccaca AACTTTA aaacacaggg 154 0.304709 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 452 458 455 -w 0.166205 >2 435 441 438 -w 1.634349 >3 660 666 663 -w 1.385042 >4 713 719 716 -w 0.387812 >5 791 797 794 -w 0.304709 >6 101 107 104 -w 0.415512 >7 699 705 702 -w 2.354571 >8 794 800 797 -w 2.354571 >9 4 10 7 -w 0.692521 >10 148 154 151 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 3 57 38 . . 0.7 4 . . . 94 1.3 5 85 . . . 1.0 6 . . . 85 1.0 7 57 . 29 . 0.5 non- site 30 . . . site 50 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 3 5 4 . . 7 4 . . . 15 13 5 12 . . . 10 6 . . . 12 10 7 5 . 2 . 5 site 4 . . . 2 Weighted motif model: POS A C G T Prob 1 0.873941 0.081081 0.016568 0.028409 1.062824 3 0.483611 0.471411 0.016568 0.028409 0.749284 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.909197 0.018125 0.016568 0.056110 1.169907 6 0.027807 0.018125 0.044269 0.909799 1.153355 7 0.607006 0.033235 0.331350 0.028409 0.701776 Conservedness in bits: 6.106833 Conservedness in prob: 8.443170 Concensus sequence: ACTATA Complete log-likelihood ratio = 68 bits Missing position information = 56 bits Log-likelihood ratio statistic = 11 bits Degrees of freedom = 18 Information per parameter = 0.649 bits MOTIF B 1-1 754 tataatcttc GACTCG cataatatag 759 0.166205 2-1 459 aattagcgtt GCCTCA tcaatgcgag 464 1.634349 3-1 180 atatcaggta GCCGCA ctcaacttgt 185 1.385042 4-1 107 CTTGCAAAcg GCCGCC tctgccatgg 112 0.387812 5-1 171 ttacagaagg GCCGCA ttagagtgaa 176 0.304709 6-1 380 attgcgaagc GCTTCA gtgaaaaaat 385 0.415512 7-1 526 tgaagacgag GACGCA cggaggagag 531 2.354571 8-1 174 TTTTtggatg GACGCA aagaagttta 179 2.354571 9-1 533 ttttattgct GCCTCA atctccatta 538 0.692521 10-1 317 caactgacga GATGCA gtaaaaagag 322 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 754 759 756 -w 0.166205 >2 459 464 461 -w 1.634349 >3 180 185 182 -w 1.385042 >4 107 112 109 -w 0.387812 >5 171 176 173 -w 0.304709 >6 380 385 382 -w 0.415512 >7 526 531 528 -w 2.354571 >8 174 179 176 -w 2.354571 >9 533 538 535 -w 0.692521 >10 317 322 319 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 93 . 1.9 2 39 56 . . 0.8 3 . 75 . . 1.1 4 . . 56 39 0.9 5 . 93 . . 1.8 6 76 . . . 0.7 non- site . 19 18 . site . 41 28 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 22 . 19 2 1 8 . . 8 3 . 14 . . 11 4 . . 9 1 9 5 . 21 . . 18 6 10 . . . 7 site . 4 2 . 3 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.925659 0.028409 1.913088 2 0.498721 0.456302 0.016568 0.028409 0.741202 3 0.027807 0.861741 0.016568 0.093884 1.503407 4 0.027807 0.018125 0.661242 0.292826 1.043052 5 0.027807 0.927216 0.016568 0.028409 1.804236 6 0.886533 0.053381 0.031678 0.028409 1.081305 Conservedness in bits: 8.086290 Conservedness in prob: 11.262748 Concensus sequence: GCCGCA Complete log-likelihood ratio = 90 bits Missing position information = 68 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.23 bits MOTIF C 1-1 522 ttatgcatag TTTTAGCCAGATATT tttgggcccg 536 0.166205 2-1 45 AGGAAaatat ACATCGCAGGGGGTT gacttttacc 59 1.634349 3-1 527 gatggggagc AAATGGCATTATACT cctgctagaa 541 1.385042 4-1 225 gaatttatcc TGCTGGTCTTCTGGT ctgttagggc 239 0.387812 5-1 487 TCCctcattg TCATAGCAAGGTCAT ttcgccttct 501 0.304709 6-1 163 tataacgaat TTTATGCTATTTTTT aaatttggag 177 0.415512 7-1 721 gtatatggtg GTAATGCCATGTAAT atgattatta 735 2.354571 8-1 578 ccataggatg ATAATGCGATTAGTT ttttagcctt 592 2.354571 9-1 636 ttttattaaa AAACAGCATGGAGTT ttttaataac 650 0.692521 10-1 37 agcatcacaa AATACGCAATAATAA cgagtagtaa 51 0.304709 sites: * ** * * * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 522 536 529 -w 0.166205 >2 45 59 52 -w 1.634349 >3 527 541 534 -w 1.385042 >4 225 239 232 -w 0.387812 >5 487 501 494 -w 0.304709 >6 163 177 170 -w 0.415512 >7 721 735 728 -w 2.354571 >8 578 592 585 -w 2.354571 >9 636 650 643 -w 0.692521 >10 37 51 44 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 48 . . 39 0.3 6 . . 93 . 1.9 7 . 84 . . 1.4 10 . . 38 57 0.7 12 . . . 57 0.4 15 . . . 85 0.9 non- site . . 18 31 site . . 26 43 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 3 . . 1 3 6 . . 22 . 19 7 . 17 . . 14 10 . . 4 5 7 12 . . . 5 4 15 . . . 12 9 site . . 1 2 1 Weighted motif model: POS A C G T Prob 1 0.607006 0.018125 0.230620 0.144249 0.454924 6 0.027807 0.018125 0.925659 0.028409 1.913088 7 0.027807 0.891960 0.016568 0.063665 1.628326 10 0.027807 0.018125 0.270912 0.683156 0.766884 12 0.332516 0.018125 0.165145 0.484214 0.259799 15 0.055508 0.018125 0.016568 0.909799 1.145941 Conservedness in bits: 6.168963 Conservedness in prob: 8.796664 Concensus sequence: AGCTTT Complete log-likelihood ratio = 67 bits Missing position information = 58 bits Log-likelihood ratio statistic = 9 bits Degrees of freedom = 18 Information per parameter = 0.538 bits MOTIF D 1-1 35 gacgctatgt CCGTCGA tgacttgaag 41 0.166205 2-1 477 aatgcgagat CCGTTTA accggaccct 483 1.634349 3-1 384 caggaaggca CCGGCGG tctttcgtcc 390 1.385042 4-1 437 tgccactgct GCTACGG aaaaccaacc 443 0.387812 5-1 420 agttataaca CCGGCGA acaatcgggg 426 0.304709 6-1 630 tgaccgtgat CCGAAGG actggctata 636 0.415512 7-1 546 ggagagtctt CCGTCGG agggctgtcg 552 2.354571 8-1 381 cgacagccct CCGACGG AAGACTCTCC 387 2.354571 9-1 93 tattagggag CCGCCGG tactaataac 99 0.692521 10-1 478 cagaaaaatt CCGATGG aCAAGAAgat 484 0.304709 sites: *** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 35 41 38 -w 0.166205 >2 477 483 480 -w 1.634349 >3 384 390 387 -w 1.385042 >4 437 443 440 -w 0.387812 >5 420 426 423 -w 0.304709 >6 630 636 633 -w 0.415512 >7 546 552 549 -w 2.354571 >8 381 387 384 -w 2.354571 >9 93 99 96 -w 0.692521 >10 478 484 481 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.5 2 . 93 . . 1.8 3 . . 83 . 1.5 5 . 65 . . 0.8 6 . . 83 . 1.5 7 . . 65 . 1.0 non- site . 19 18 . site . 43 43 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 15 2 . 21 . . 18 3 . . 18 . 15 5 . 11 . . 8 6 . . 18 . 15 7 . . 12 . 10 site . 5 5 . 7 Weighted motif model: POS A C G T Prob 1 0.027807 0.891960 0.051824 0.028409 1.639472 2 0.027807 0.927216 0.016568 0.028409 1.804236 3 0.027807 0.018125 0.890403 0.063665 1.732697 5 0.065581 0.713164 0.016568 0.204687 0.983371 6 0.027807 0.018125 0.777082 0.176986 1.321705 7 0.219194 0.018125 0.734272 0.028409 1.209821 Conservedness in bits: 8.691302 Conservedness in prob: 12.608748 Concensus sequence: CCGCGG Complete log-likelihood ratio = 101 bits Missing position information = 82 bits Log-likelihood ratio statistic = 18 bits Degrees of freedom = 18 Information per parameter = 1.04 bits MOTIF E 1-1 103 gaagtacaac GCTTTCAT tgcttccgaa 110 0.166205 2-1 231 cctcgtaatc ATTTTCTT gtatttatcg 238 1.634349 3-1 131 gaccagggga ACTTTCCA gattcagatc 138 1.385042 4-1 614 aatatcctat ATTTTCTT catttaccgg 621 0.387812 5-1 271 tttaaatttc ACTTTCTA aagtcccaga 278 0.304709 6-1 212 tgtcacagcg AATTTCCT cacatgtagg 219 0.415512 7-1 384 ttgattcgtt AATTTGAA ggtttgtggg 391 2.354571 8-1 272 aaagagcccc ATTATCTT agccTAAAAA 279 2.354571 9-1 596 ttcttctcaa ACTTTGTA atgcgcctgt 603 0.692521 10-1 647 gcccttttcc ATTTTCCA ttaaatctct 654 0.304709 sites: * **** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 103 110 106 -w 0.166205 >2 231 238 234 -w 1.634349 >3 131 138 134 -w 1.385042 >4 614 621 617 -w 0.387812 >5 271 278 274 -w 0.304709 >6 212 219 215 -w 0.415512 >7 384 391 387 -w 2.354571 >8 272 279 275 -w 2.354571 >9 596 603 599 -w 0.692521 >10 647 654 650 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 3 . . . 94 1.3 4 . . . 85 0.9 5 . . . 94 1.3 6 . 75 . . 1.2 8 48 . . 48 0.5 non- site . . . 31 site . . . 56 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 3 . . . 15 13 4 . . . 12 9 5 . . . 15 13 6 . 14 . . 12 8 3 . . 3 5 site . . . 5 2 Weighted motif model: POS A C G T Prob 1 0.921788 0.018125 0.031678 0.028409 1.226071 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.241859 0.018125 0.016568 0.723448 0.674165 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.650208 0.293576 0.028409 1.116326 8 0.486130 0.018125 0.016568 0.479177 0.500420 Conservedness in bits: 6.056358 Conservedness in prob: 8.346266 Concensus sequence: ATTTCA Complete log-likelihood ratio = 79 bits Missing position information = 59 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.1 bits MOTIF F 1-1 149 ccaagactat TGGGTCCTCA attgtccaag 158 0.166205 2-1 207 acatgtacat ACCTCTCTCC gtatcctcgt 216 1.634349 3-1 29 gacgacagta ATATGTCTCC tacaatacca 38 1.385042 4-1 262 ggttggcctc TACTTACTCC atcgacaatt 271 0.387812 5-1 470 ggaagggcgg TCTTTTCTCC ctcattgTCA 479 0.304709 6-1 494 ttaaattgct TTGCCTCTCC ttttggaaag 503 0.415512 7-1 138 gtcattatag TTTTTTCTCC ttgacgttaa 147 2.354571 8-1 388 cctCCGACGG AAGACTCTCC tccgtgcgtc 397 2.354571 9-1 170 gcggaaaaaa AGTTATCACC ccgccccctc 179 0.692521 10-1 508 aaaaAAAAAA AGCTTTCACC gatttcctag 517 0.304709 sites: * ***** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 149 158 153 -w 0.166205 >2 207 216 211 -w 1.634349 >3 29 38 33 -w 1.385042 >4 262 271 266 -w 0.387812 >5 470 479 474 -w 0.304709 >6 494 503 498 -w 0.415512 >7 138 147 142 -w 2.354571 >8 388 397 392 -w 2.354571 >9 170 179 174 -w 0.692521 >10 508 517 512 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 48 . . 48 0.5 6 . . . 76 0.6 7 . 93 . . 1.8 8 . . . 76 0.7 9 . 93 . . 1.8 10 . 84 . . 1.4 non- site . 19 . 31 site . 50 . 35 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 3 . . 3 5 6 . . . 10 6 7 . 21 . . 18 8 . . . 10 7 9 . 21 . . 18 10 . 17 . . 14 site . 7 . 1 6 Weighted motif model: POS A C G T Prob 1 0.607006 0.018125 0.016568 0.358301 0.550868 6 0.063062 0.033235 0.016568 0.887135 1.048521 7 0.027807 0.927216 0.016568 0.028409 1.804236 8 0.118464 0.018125 0.016568 0.846843 0.935825 9 0.027807 0.927216 0.016568 0.028409 1.804236 10 0.042916 0.912106 0.016568 0.028409 1.723711 Conservedness in bits: 7.867398 Conservedness in prob: 10.560863 Concensus sequence: ATCTCC Complete log-likelihood ratio = 84 bits Missing position information = 72 bits Log-likelihood ratio statistic = 12 bits Degrees of freedom = 18 Information per parameter = 0.695 bits MOTIF G 1-1 444 cacttccgag CGATTA atACATATCt 449 0.166205 2-1 34 attgattgta CAGGAA aatatACATC 39 1.634349 3-1 329 ctattagtag CTAAAA atgggtcacg 334 1.385042 4-1 474 aacttcttca CTATAA gaaaatcaca 479 0.387812 5-1 243 agtatgacct CTGTTA aatttttttt 248 0.304709 6-1 578 ttccttaacc CAAAAA taagggaaag 583 0.415512 7-1 83 ttcctttgcg CTAGAA ttgaactcag 88 2.354571 8-1 643 gatttttgat CTATTA acagatatat 648 2.354571 9-1 309 aaattattcc CTAGAA caagcgggaA 314 0.692521 10-1 486 ttCCGATGGa CAAGAA gataggaaaa 491 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 444 449 446 -w 0.166205 >2 34 39 36 -w 1.634349 >3 329 334 331 -w 1.385042 >4 474 479 476 -w 0.387812 >5 243 248 245 -w 0.304709 >6 578 583 580 -w 0.415512 >7 83 88 85 -w 2.354571 >8 643 648 645 -w 2.354571 >9 309 314 311 -w 0.692521 >10 486 491 488 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 . . . 57 0.4 3 76 . . . 0.8 4 . . 38 39 0.4 5 66 . . . 0.6 6 94 . . . 1.3 non- site 30 . . . site 50 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 . . . 5 4 3 10 . . . 8 4 . . 4 1 4 5 7 . . . 6 6 15 . . . 13 site 4 . . . 1 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.241859 0.018125 0.031678 0.708339 0.611647 3 0.760620 0.018125 0.192846 0.028409 0.854373 4 0.191494 0.018125 0.469855 0.320527 0.461604 5 0.680035 0.018125 0.016568 0.285271 0.626317 6 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 5.652922 Conservedness in prob: 8.846149 Concensus sequence: CTAGAA Complete log-likelihood ratio = 67 bits Missing position information = 52 bits Log-likelihood ratio statistic = 14 bits Degrees of freedom = 18 Information per parameter = 0.825 bits MOTIF H 1-1 477 tttaaatacc TTTTTT aatacgtatg 482 0.166205 2-1 648 aggcagtaaa ATTTTT actgaaacgt 653 1.634349 3-1 445 tgccttggac GATATT aaggcagaag 450 1.385042 4-1 559 tttatacccc TTTCTT ctctcccctg 564 0.387812 5-1 216 ccagttctac ATTTTT ttttttttgg 221 0.304709 6-1 554 tcattagata TATTTT ctgtcatttt 559 0.415512 7-1 780 AAaagtaaga ATTTTT gaaaattcaa 785 2.354571 8-1 162 attcttactt TTTTTT tggatgGACG 167 2.354571 9-1 704 actccaagta TTTTTT aacgtatatt 709 0.692521 10-1 358 ctttttgtcc TTTTTT ttttccgggg 363 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 477 482 479 -w 0.166205 >2 648 653 650 -w 1.634349 >3 445 450 447 -w 1.385042 >4 559 564 561 -w 0.387812 >5 216 221 218 -w 0.304709 >6 554 559 556 -w 0.415512 >7 780 785 782 -w 2.354571 >8 162 167 164 -w 2.354571 >9 704 709 706 -w 0.692521 >10 358 363 360 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 57 0.4 2 . . . 76 0.7 3 . . . 94 1.3 4 . . . 76 0.6 5 . . . 94 1.3 6 . . . 94 1.3 non- site . . . 31 site . . . 86 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 5 4 2 . . . 10 7 3 . . . 15 13 4 . . . 10 6 5 . . . 15 13 6 . . . 15 13 site . . . 13 10 Weighted motif model: POS A C G T Prob 1 0.418137 0.018125 0.142481 0.421257 0.256786 2 0.191494 0.018125 0.016568 0.773813 0.762847 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.153720 0.053381 0.016568 0.776332 0.707794 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 5.536491 Conservedness in prob: 7.826866 Concensus sequence: ATTTTT Complete log-likelihood ratio = 71 bits Missing position information = 51 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.11 bits MOTIF I 1-1 671 tgccttactt TAAAAG catgttgagt 676 0.166205 2-1 778 aaataaaagt AAAAAG gtagggcaac 783 1.634349 3-1 106 ctgtactaat CCAAGG aggtttacgg 111 1.385042 4-1 680 ttcataataa CCAAAA gctcataact 685 0.387812 5-1 648 agctttcagg AAAAGA ctacggcagt 653 0.304709 6-1 599 gaaagggtcc AAAAAG cgctcggaca 604 0.415512 7-1 766 cgtccatcca AAAAAA aagtaagaAT 771 2.354571 8-1 284 TATCTTagcc TAAAAA aaccttctct 289 2.354571 9-1 324 Acaagcggga AAAAGG tccggggaaa 329 0.692521 10-1 502 gataggaaaa AAAAAA AGCTTTCACC 507 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 671 676 673 -w 0.166205 >2 778 783 780 -w 1.634349 >3 106 111 108 -w 1.385042 >4 680 685 682 -w 0.387812 >5 648 653 650 -w 0.304709 >6 599 604 601 -w 0.415512 >7 766 771 768 -w 2.354571 >8 284 289 286 -w 2.354571 >9 324 329 326 -w 0.692521 >10 502 507 504 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 57 . . . 0.3 2 76 . . . 0.8 3 94 . . . 1.3 4 94 . . . 1.3 5 66 . 29 . 0.8 6 48 . 47 . 0.8 non- site 30 . . . site 76 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 5 . . . 3 2 10 . . . 8 3 15 . . . 13 4 15 . . . 13 5 7 . 2 . 8 6 3 . 6 . 8 site 10 . . . 7 Weighted motif model: POS A C G T Prob 1 0.546568 0.179293 0.016568 0.257571 0.301117 2 0.775729 0.179293 0.016568 0.028409 0.858446 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.720328 0.018125 0.233138 0.028409 0.811962 6 0.546568 0.018125 0.406898 0.028409 0.768239 Conservedness in bits: 5.329252 Conservedness in prob: 7.804428 Concensus sequence: AAAAAG Complete log-likelihood ratio = 71 bits Missing position information = 51 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.08 bits MOTIF J 1-1 583 gtatattgca CCGATCCGATTCTTA ctccatatca 597 0.166205 2-1 517 cacgttcggt CCACTGTGTGCCGAA catgctcctt 531 1.634349 3-1 418 gatatctgcg CCGTTCAGGGGTCCA tgtgccttgg 432 1.385042 4-1 90 aatacggcag CCGTTGTCTTGCAAA cgGCCGCCtc 104 0.387812 5-1 69 tctgcgcgcg CCAATGTCCCCGCAA ctactcaata 83 0.304709 6-1 526 atacttcgga GCACTGTTGAGCGAA ggctcattag 540 0.415512 7-1 57 cacttttcgg CCAATGGTCTTGGTA attcctttgc 71 2.354571 8-1 62 agtgtgtgaa CCAATGTATCCAGCA ccacctgtaa 76 2.354571 9-1 265 tccttgaaac CCAGTCATACTATGA agtccctaaa 279 0.692521 10-1 189 atgctttcaa CCGCTGCGTTTTGGA tacctattct 203 0.304709 sites: *** ** * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 583 597 590 -w 0.166205 >2 517 531 524 -w 1.634349 >3 418 432 425 -w 1.385042 >4 90 104 97 -w 0.387812 >5 69 83 76 -w 0.304709 >6 526 540 533 -w 0.415512 >7 57 71 64 -w 2.354571 >8 62 76 69 -w 2.354571 >9 265 279 272 -w 0.692521 >10 189 203 196 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.5 2 . 93 . . 1.8 3 57 . 38 . 0.8 5 . . . 94 1.3 6 . 29 65 . 1.2 15 94 . . . 1.3 non- site . 19 . . site . 36 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 15 2 . 21 . . 18 3 5 . 4 . 8 5 . . . 15 13 6 . 2 12 . 12 15 15 . . . 13 site . 3 . . 1 Weighted motif model: POS A C G T Prob 1 0.027807 0.889442 0.054342 0.028409 1.629552 2 0.027807 0.927216 0.016568 0.028409 1.804236 3 0.732919 0.018125 0.220547 0.028409 0.823705 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.222104 0.721680 0.028409 1.272971 15 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 8.094897 Conservedness in prob: 10.820901 Concensus sequence: CCATGA Complete log-likelihood ratio = 99 bits Missing position information = 75 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.34 bits seed 3 time: 6 seconds (0.10 minutes) MOTIF A 1-1 343 gtctgttaac TTCTTTGT tTCTTTGTTG 350 0.166205 2-1 310 cgcttttact ATTATCTT ctacgctgac 317 1.634349 3-1 711 tgaattgctc TTCATTAT gcaccttatt 718 1.385042 4-1 197 ttgggcaagt GTCTTTTT atgtatcgtg 204 0.387812 5-1 217 cagttctaca TTTTTTTT tttttggaag 224 0.304709 6-1 125 tatcttttag TTCTTAAT tgcaacacat 132 0.415512 7-1 456 gtattgtaga ATCTTTAT tgttcggagC 463 2.354571 8-1 236 tccatatcta ATCTTACT tatatgttgt 243 2.354571 9-1 522 ttcatcccac ATTTTATT gctgcctcaA 529 0.692521 10-1 714 taaaactcct TTCTTAAT ttcactctaa 721 0.304709 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 343 350 346 -w 0.166205 >2 310 317 313 -w 1.634349 >3 711 718 714 -w 1.385042 >4 197 204 200 -w 0.387812 >5 217 224 220 -w 0.304709 >6 125 132 128 -w 0.415512 >7 456 463 459 -w 2.354571 >8 236 243 239 -w 2.354571 >9 522 529 525 -w 0.692521 >10 714 721 717 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 39 . . 48 0.3 2 . . . 94 1.3 3 . 65 . . 1.0 4 . . . 76 0.7 5 . . . 94 1.3 8 . . . 94 1.3 non- site . . . 31 site . . . 76 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 1 . . 3 3 2 . . . 15 13 3 . 11 . . 10 4 . . . 10 7 5 . . . 15 13 8 . . . 15 13 site . . . 10 7 Weighted motif model: POS A C G T Prob 1 0.667444 0.018125 0.051824 0.262607 0.528721 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.687981 0.016568 0.267644 1.016002 4 0.302297 0.018125 0.016568 0.663010 0.594331 5 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 5.948117 Conservedness in prob: 8.752652 Concensus sequence: ATCTTT Complete log-likelihood ratio = 73 bits Missing position information = 53 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.11 bits MOTIF B 1-1 191 ccaaccccag TTTCTCACAACGA tgacttgtac 203 0.166205 2-1 461 ttagcgttgc CTCATCAATGCGA gatccgttta 473 1.634349 3-1 473 agtatcgggg CGGATCACTCCGA accgagatta 485 1.385042 4-1 419 caatgctaat CCGGTCACTGCCA ctgcTGCTAC 431 0.387812 5-1 13 cttagtatct CATCTCATCTCAA tttctatatt 25 0.304709 6-1 358 acttttgata TCACTCACAACTA ttgcgaagcg 370 0.415512 7-1 404 tttgtggggc CAGGTTACTGCCA atttttcctc 416 2.354571 8-1 325 atacgcttaa CTGCTCATTGCTA tattgaagta 337 2.354571 9-1 688 aAGATTTGTT CATTTCACTCCAA gtatttttta 700 0.692521 10-1 620 ataaactatt TGATTCAGCGCCA atttgccctt 632 0.304709 sites: * *** * * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 191 203 197 -w 0.166205 >2 461 473 467 -w 1.634349 >3 473 485 479 -w 1.385042 >4 419 431 425 -w 0.387812 >5 13 25 19 -w 0.304709 >6 358 370 364 -w 0.415512 >7 404 416 410 -w 2.354571 >8 325 337 331 -w 2.354571 >9 688 700 694 -w 0.692521 >10 620 632 626 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 65 . . 1.0 5 . . . 94 1.3 6 . 84 . . 1.4 7 94 . . . 1.3 11 . 93 . . 1.8 13 94 . . . 1.3 non- site . 19 . . site . 43 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 11 . . 10 5 . . . 15 13 6 . 17 . . 14 7 15 . . . 13 11 . 21 . . 18 13 15 . . . 13 site . 5 . . 4 Weighted motif model: POS A C G T Prob 1 0.027807 0.846632 0.016568 0.108993 1.447145 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.713164 0.016568 0.242461 1.069052 7 0.936898 0.018125 0.016568 0.028409 1.294744 11 0.027807 0.927216 0.016568 0.028409 1.804236 13 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 8.179610 Conservedness in prob: 10.957281 Concensus sequence: CTCACA Complete log-likelihood ratio = 101 bits Missing position information = 78 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.25 bits MOTIF C 1-1 73 gAACAAGAAg TTAATCAAGA agttgtctaa 82 0.166205 2-1 666 tgaaacgtat ATAATCATCA taagcgacaa 675 1.634349 3-1 731 accttattca ATTATCATCA agaatAGTAA 740 1.385042 4-1 717 acctgaatat ATATACATCA catatcactg 726 0.387812 5-1 697 TAAAACcggg AGAATCAAGA cattctaatg 706 0.304709 6-1 760 tatgcagagc ATCAACATGA taaaaaaaaa 769 0.415512 7-1 430 tttcctcttc ATAACCATAA aagctagtat 439 2.354571 8-1 743 tcataaaagt ATCAACAAAA aattgttaat 752 2.354571 9-1 539 Tgctgcctca ATCTCCATTA agaaaaaaaa 548 0.692521 10-1 549 gtcgtatgac ATCAGAATGA aaaattttca 558 0.304709 sites: ** * ** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 73 82 77 -w 0.166205 >2 666 675 670 -w 1.634349 >3 731 740 735 -w 1.385042 >4 717 726 721 -w 0.387812 >5 697 706 701 -w 0.304709 >6 760 769 764 -w 0.415512 >7 430 439 434 -w 2.354571 >8 743 752 747 -w 2.354571 >9 539 548 543 -w 0.692521 >10 549 558 553 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 2 . . . 85 1.0 4 76 . . . 0.7 6 . 84 . . 1.4 7 94 . . . 1.3 10 94 . . . 1.3 non- site 30 . . . site 63 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 2 . . . 12 10 4 10 . . . 7 6 . 17 . . 14 7 15 . . . 13 10 15 . . . 13 site 7 . . . 4 Weighted motif model: POS A C G T Prob 1 0.921788 0.018125 0.016568 0.043519 1.223227 2 0.027807 0.018125 0.044269 0.909799 1.153355 4 0.838686 0.018125 0.016568 0.126621 0.935397 6 0.055508 0.899515 0.016568 0.028409 1.662977 7 0.936898 0.018125 0.016568 0.028409 1.294744 10 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 7.564444 Conservedness in prob: 9.991935 Concensus sequence: ATACAA Complete log-likelihood ratio = 83 bits Missing position information = 66 bits Log-likelihood ratio statistic = 17 bits Degrees of freedom = 18 Information per parameter = 0.97 bits MOTIF D 1-1 64 gttgaacaag AACAAGAA gTTAATCAAG 71 0.166205 2-1 765 gtgcaaaaag AGAAAATA aaagtaaaaa 772 1.634349 3-1 778 gattaacata ATAAAAAA aataattctt 785 1.385042 4-1 679 attcataata ACCAAAAG ctcataactt 686 0.387812 5-1 685 ttactgggcg TATAAAAC cgggAGAATC 692 0.304709 6-1 25 ttgtgtaacc TTGAAAAA cggtgaaact 32 0.415512 7-1 765 gcgtccatcc AAAAAAAA agtaagaatt 772 2.354571 8-1 788 aacgtcaagg AGAAAAAA ctata 795 2.354571 9-1 630 ttcttttttt ATTAAAAA acagcatgga 637 0.692521 10-1 498 agaagatagg AAAAAAAA aaagctttca 505 0.304709 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 64 71 67 -w 0.166205 >2 765 772 768 -w 1.634349 >3 778 785 781 -w 1.385042 >4 679 686 682 -w 0.387812 >5 685 692 688 -w 0.304709 >6 25 32 28 -w 0.415512 >7 765 772 768 -w 2.354571 >8 788 795 791 -w 2.354571 >9 630 637 633 -w 0.692521 >10 498 505 501 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.7 4 94 . . . 1.3 5 94 . . . 1.3 6 85 . . . 1.0 7 85 . . . 1.0 8 76 . . . 0.7 non- site 30 . . . site 90 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 7 4 15 . . . 13 5 15 . . . 13 6 12 . . . 10 7 12 . . . 10 8 10 . . . 7 site 14 . . . 11 Weighted motif model: POS A C G T Prob 1 0.871423 0.018125 0.016568 0.093884 1.033326 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.921788 0.018125 0.031678 0.028409 1.226071 7 0.788321 0.018125 0.016568 0.176986 0.811534 8 0.873941 0.045826 0.051824 0.028409 1.034159 Conservedness in bits: 6.694579 Conservedness in prob: 9.212257 Concensus sequence: AAAAAA Complete log-likelihood ratio = 75 bits Missing position information = 61 bits Log-likelihood ratio statistic = 13 bits Degrees of freedom = 18 Information per parameter = 0.738 bits MOTIF E 1-1 352 cTTCTTTGTt TCTTTGTTGAA gaagaactgg 362 0.166205 2-1 603 catcacacgg TCTTTTATGCA attgattgac 613 1.634349 3-1 241 tgcggtagaa TCTTTTCACAA aaggtactca 251 1.385042 4-1 613 taatatccta TATTTTCTTCA tttaccggcg 623 0.387812 5-1 256 TTaaattttt TTTTTTTTAAA tttcactttc 266 0.304709 6-1 170 aattttatgc TATTTTTTAAA tttggagttC 180 0.415512 7-1 265 gttatgcagc TTTTCCATTTA tatatctgtt 275 2.354571 8-1 161 aattcttact TTTTTTTTGGA tggacgcaaa 171 2.354571 9-1 303 attccgaaat TATTCCCTAGA acaagcggga 313 0.692521 10-1 648 cccttttcca TTTTCCATTAA atctctgttc 658 0.304709 sites: * *** * * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 352 362 357 -w 0.166205 >2 603 613 608 -w 1.634349 >3 241 251 246 -w 1.385042 >4 613 623 618 -w 0.387812 >5 256 266 261 -w 0.304709 >6 170 180 175 -w 0.415512 >7 265 275 270 -w 2.354571 >8 161 171 166 -w 2.354571 >9 303 313 308 -w 0.692521 >10 648 658 653 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 3 . . . 94 1.3 4 . . . 94 1.3 5 . 29 . 66 0.7 8 . . . 85 0.9 11 94 . . . 1.3 non- site . . . 31 site . . . 76 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 3 . . . 15 13 4 . . . 15 13 5 . 2 . 7 7 8 . . . 12 9 11 15 . . . 13 site . . . 10 8 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.322834 0.016568 0.632791 0.715058 8 0.153720 0.018125 0.016568 0.811587 0.844859 11 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.663725 Conservedness in prob: 8.764599 Concensus sequence: TTTTTA Complete log-likelihood ratio = 89 bits Missing position information = 66 bits Log-likelihood ratio statistic = 23 bits Degrees of freedom = 18 Information per parameter = 1.31 bits MOTIF F 1-1 544 atttttgggc CCGGAATA tatcttttcg 551 0.166205 2-1 641 aacacatagg CAGTAAAA tttttactga 648 1.634349 3-1 24 tccaagacga CAGTAATA tgtctcctac 31 1.385042 4-1 572 cttctctccc CTGCAATA taatAGTTTA 579 0.387812 5-1 644 accgagcttt CAGGAAAA gactacggca 651 0.304709 6-1 190 Atttggagtt CAGTGATA aaagtgtCAC 197 0.415512 7-1 324 ttaattaccc CAGAAATA aggctaaaaa 331 2.354571 8-1 9 caggttat CAGCAACA acacagtcat 16 2.354571 9-1 747 aaaccacaag CAGCAATA caaagagaat 754 0.692521 10-1 468 aaagaaatga CAGAAAAA ttccgatgga 475 0.304709 sites: *** ** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 544 551 547 -w 0.166205 >2 641 648 644 -w 1.634349 >3 24 31 27 -w 1.385042 >4 572 579 575 -w 0.387812 >5 644 651 647 -w 0.304709 >6 190 197 193 -w 0.415512 >7 324 331 327 -w 2.354571 >8 9 16 12 -w 2.354571 >9 747 754 750 -w 0.692521 >10 468 475 471 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 76 . . . 0.7 3 . . 93 . 1.9 5 85 . . . 1.0 6 94 . . . 1.3 8 94 . . . 1.3 non- site 30 . . . site 61 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 10 . . . 7 3 . . 22 . 19 5 12 . . . 10 6 15 . . . 13 8 15 . . . 13 site 6 . . . 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.886533 0.033235 0.016568 0.063665 1.071685 3 0.027807 0.018125 0.925659 0.028409 1.913088 5 0.899124 0.018125 0.054342 0.028409 1.142806 6 0.936898 0.018125 0.016568 0.028409 1.294744 8 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 8.521304 Conservedness in prob: 10.882691 Concensus sequence: CAGAAA Complete log-likelihood ratio = 101 bits Missing position information = 75 bits Log-likelihood ratio statistic = 25 bits Degrees of freedom = 18 Information per parameter = 1.44 bits MOTIF G 1-1 260 caattgaaga AGGTCTTGT gtttggctgt 268 0.166205 2-1 696 gtgaggcaac ACCTTTGTT accacattga 704 1.634349 3-1 75 cacatctatt ACATTTACT gagcataacg 83 1.385042 4-1 584 GCAATAtaat AGTTTAATT ctaatattaa 592 0.387812 5-1 239 tggaagtatg ACCTCTGTT aaatttttTT 247 0.304709 6-1 143 tgcaacacat AGATTTGCT gtataacgaa 151 0.415512 7-1 694 catataagta AGATTAGAT atggatatgt 702 2.354571 8-1 489 ctacaatact AGCTTTTAT ggttatgaag 497 2.354571 9-1 679 acatacaaaa AGATTTGTT CATTTCACTC 687 0.692521 10-1 347 ccgtcttgaa ACTTTTTGT cctttttttt 355 0.304709 sites: ** *** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 260 268 264 -w 0.166205 >2 696 704 700 -w 1.634349 >3 75 83 79 -w 1.385042 >4 584 592 588 -w 0.387812 >5 239 247 243 -w 0.304709 >6 143 151 147 -w 0.415512 >7 694 702 698 -w 2.354571 >8 489 497 493 -w 2.354571 >9 679 687 683 -w 0.692521 >10 347 355 351 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 . 38 56 . 1.1 4 . . . 94 1.3 5 . . . 76 0.8 6 . . . 76 0.7 9 . . . 94 1.3 non- site . . . 31 site . . . 60 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 . 4 9 . 11 4 . . . 15 13 5 . . . 10 8 6 . . . 10 7 9 . . . 15 13 site . . . 6 3 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.027807 0.348017 0.595767 0.028409 1.103282 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.060935 0.016568 0.894690 1.099999 6 0.277114 0.018125 0.016568 0.688193 0.624324 9 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.661726 Conservedness in prob: 9.150192 Concensus sequence: AGTTTT Complete log-likelihood ratio = 83 bits Missing position information = 62 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.15 bits MOTIF H 1-1 293 gttggtaacg TTGAAATG gaagaagacg 300 0.166205 2-1 35 ttgattgtac AGGAAAAT atacatcgca 42 1.634349 3-1 637 ctaaaatgtg GAGATAGG ataagttttg 644 1.385042 4-1 273 acttactcca TCGACAAT tcaagataca 280 0.387812 5-1 782 agctctcatt ACTAAATT aagatagaaa 789 0.304709 6-1 293 aatctatgga AAGATATG gacggtagca 300 0.415512 7-1 351 aactaatcgc ATTATCAT cctatggttG 358 2.354571 8-1 575 caaccatagg ATGATAAT gcgattagtt 582 2.354571 9-1 334 aaaaggtccg GGGAAATG gagtCCGTGC 341 0.692521 10-1 108 aaatgattgt ATGATAAT gttttcaatg 115 0.304709 sites: * **** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 293 300 296 -w 0.166205 >2 35 42 38 -w 1.634349 >3 637 644 640 -w 1.385042 >4 273 280 276 -w 0.387812 >5 782 789 785 -w 0.304709 >6 293 300 296 -w 0.415512 >7 351 358 354 -w 2.354571 >8 575 582 578 -w 2.354571 >9 334 341 337 -w 0.692521 >10 108 115 111 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 57 . . . 0.4 3 . . 74 . 1.2 4 94 . . . 1.3 5 39 . . 48 0.3 6 85 . . . 1.0 8 . . 38 57 0.7 non- site 30 . 18 . site 48 . 23 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 5 . . . 4 3 . . 15 . 12 4 15 . . . 13 5 1 . . 3 3 6 12 . . . 10 8 . . 4 5 7 site 3 . 1 . 2 Weighted motif model: POS A C G T Prob 1 0.697663 0.018125 0.205437 0.078774 0.646118 3 0.027807 0.018125 0.683906 0.270162 1.089171 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.282151 0.053381 0.016568 0.647900 0.489875 6 0.722846 0.232177 0.016568 0.028409 0.792291 8 0.027807 0.018125 0.258321 0.695747 0.774485 Conservedness in bits: 5.086684 Conservedness in prob: 8.159787 Concensus sequence: AGATAT Complete log-likelihood ratio = 60 bits Missing position information = 50 bits Log-likelihood ratio statistic = 9 bits Degrees of freedom = 18 Information per parameter = 0.537 bits MOTIF I 1-1 131 gttttgatca AGCAAG ttccaagact 136 0.166205 2-1 77 accatttcac CGCAAT ggaatcaaac 82 1.634349 3-1 746 CATCAagaat AGTAAT agttaagtaa 751 1.385042 4-1 330 agagagaagg AGCAAG caactgaccc 335 0.387812 5-1 286 ctaaagtccc AGAAAT ccgcttgaat 291 0.304709 6-1 707 tagtttggct AGCAAA gatataaaag 712 0.415512 7-1 368 Tcctatggtt GTTAAT ttgattcgtt 373 2.354571 8-1 611 ttatttctgg GGTAAT taatcagcga 616 2.354571 9-1 98 gggagccgcc GGTACT aataacatca 103 0.692521 10-1 322 gacgagatgc AGTAAA aagagattgc 327 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 131 136 133 -w 0.166205 >2 77 82 79 -w 1.634349 >3 746 751 748 -w 1.385042 >4 330 335 332 -w 0.387812 >5 286 291 288 -w 0.304709 >6 707 712 709 -w 0.415512 >7 368 373 370 -w 2.354571 >8 611 616 613 -w 2.354571 >9 98 103 100 -w 0.692521 >10 322 327 324 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 57 . 29 . 0.5 2 . . 83 . 1.5 3 . 38 . 48 0.4 4 94 . . . 1.3 5 85 . . . 1.0 6 . . . 57 0.4 non- site 30 . 18 . site 46 . 23 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 5 . 2 . 5 2 . . 18 . 15 3 . 4 . 3 4 4 15 . . . 13 5 12 . . . 10 6 . . . 5 4 site 3 . 1 . 1 Weighted motif model: POS A C G T Prob 1 0.297260 0.166702 0.507628 0.028409 0.596625 2 0.027807 0.018125 0.711607 0.242461 1.150760 3 0.055508 0.254841 0.016568 0.673083 0.641311 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.873941 0.081081 0.016568 0.028409 1.062824 6 0.093282 0.018125 0.066933 0.821660 0.826711 Conservedness in bits: 5.572975 Conservedness in prob: 9.074174 Concensus sequence: GGTAAT Complete log-likelihood ratio = 57 bits Missing position information = 51 bits Log-likelihood ratio statistic = 6 bits Degrees of freedom = 18 Information per parameter = 0.342 bits MOTIF J 1-1 700 tttcacagat CGATATG ctttggtgtt 706 0.166205 2-1 211 gtacatacct CTCTCCG tatcctcgta 217 1.634349 3-1 399 ggtctttcgt CCGTGCG gagatatctg 405 1.385042 4-1 436 CTGCCActgc TGCTACG gaaaaccaac 442 0.387812 5-1 60 ttcactcttt CTGCGCG cgccaatgtc 66 0.304709 6-1 205 ATAaaagtgt CACAGCG aatttcctca 211 0.415512 7-1 473 Ttgttcggag CAGTGCG gcgcgaggca 479 2.354571 8-1 377 cgggcgacag CCCTCCG acggaagact 383 2.354571 9-1 346 GAAATGgagt CCGTGCG agttttgtta 352 0.692521 10-1 375 tttccgggga CTCTACG agaacccttt 381 0.304709 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 700 706 703 -w 0.166205 >2 211 217 214 -w 1.634349 >3 399 405 402 -w 1.385042 >4 436 442 439 -w 0.387812 >5 60 66 63 -w 0.304709 >6 205 211 208 -w 0.415512 >7 473 479 476 -w 2.354571 >8 377 383 380 -w 2.354571 >9 346 352 349 -w 0.692521 >10 375 381 378 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.4 3 . 47 38 . 0.7 4 . . . 76 0.6 5 . . 47 . 0.5 6 . 84 . . 1.4 7 . . 93 . 1.9 non- site . 19 18 . site . 43 31 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 14 3 . 6 4 . 7 4 . . . 10 6 5 . . 6 . 5 6 . 17 . . 14 7 . . 22 . 19 site . 5 3 . 4 Weighted motif model: POS A C G T Prob 1 0.027807 0.891960 0.016568 0.063665 1.628326 3 0.042916 0.481484 0.447190 0.028409 0.971672 4 0.065581 0.045826 0.016568 0.872025 0.990827 5 0.105873 0.380754 0.484964 0.028409 0.779806 6 0.027807 0.912106 0.016568 0.043519 1.723618 7 0.027807 0.018125 0.925659 0.028409 1.913088 Conservedness in bits: 8.007338 Conservedness in prob: 10.887217 Concensus sequence: CGTGCG Complete log-likelihood ratio = 77 bits Missing position information = 73 bits Log-likelihood ratio statistic = 4 bits Degrees of freedom = 18 Information per parameter = 0.234 bits seed 4 time: 6 seconds (0.10 minutes) MOTIF A 1-1 581 gagtatattg CACCGATCC gattcttact 589 0.166205 2-1 208 CATgtacata CCTCTCTCC gtatcctcgt 216 1.634349 3-1 278 attCGGAAAg CTTCCTTCC ggaatggctt 286 1.385042 4-1 562 ataccccttt CTTCTCTCC cctgcaatat 570 0.387812 5-1 606 tcgcacaccg CTGCTCTCC ttaattccct 614 0.304709 6-1 85 atttgccagc TTACTATCC ttcttgaaaa 93 0.415512 7-1 756 aacttctttg CGTCCATCC aaaaaaaaag 764 2.354571 8-1 374 gagcgggcga CAGCCCTCC gacggaagac 382 2.354571 9-1 176 Aaaaagttat CACCCCGCC ccctcctccg 184 0.692521 10-1 136 taagagattt CGATTATCC acaaacttta 144 0.304709 sites: * ** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 581 589 585 -w 0.166205 >2 208 216 212 -w 1.634349 >3 278 286 282 -w 1.385042 >4 562 570 566 -w 0.387812 >5 606 614 610 -w 0.304709 >6 85 93 89 -w 0.415512 >7 756 764 760 -w 2.354571 >8 374 382 378 -w 2.354571 >9 176 184 180 -w 0.692521 >10 136 144 140 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.4 4 . 84 . . 1.4 5 . 38 . 48 0.5 7 . . . 85 1.0 8 . 93 . . 1.8 9 . 93 . . 1.8 non- site . 19 . . site . 70 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 14 4 . 17 . . 14 5 . 4 . 3 5 7 . . . 12 10 8 . 21 . . 18 9 . 21 . . 18 site . 13 . . 11 Weighted motif model: POS A C G T Prob 1 0.027807 0.889442 0.016568 0.066183 1.617179 4 0.027807 0.899515 0.016568 0.056110 1.662716 5 0.027807 0.635098 0.031678 0.305417 0.875299 7 0.027807 0.018125 0.079525 0.874544 1.044367 8 0.027807 0.927216 0.016568 0.028409 1.804236 9 0.027807 0.927216 0.016568 0.028409 1.804236 Conservedness in bits: 8.808035 Conservedness in prob: 11.922090 Concensus sequence: CCCTCC Complete log-likelihood ratio = 97 bits Missing position information = 73 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.37 bits MOTIF B 1-1 365 ttgttgaaga AGAACT ggcaaaatgt 370 0.166205 2-1 406 cgtcaagtaa AGATTT cgtgttcatg 411 1.634349 3-1 237 taaatgcggt AGAATC TTTTCAcaaa 242 1.385042 4-1 40 agatgctttc AGAGAT ggtgcttatc 45 0.387812 5-1 666 acggcagtaa AGAATT gctttaCTGG 671 0.304709 6-1 712 tggctagcaa AGATAT aaaagcaggt 717 0.415512 7-1 438 tcataaccat AAAAGC tagtattgta 443 2.354571 8-1 287 cttagcctaa AAAAAC cttctctttg 292 2.354571 9-1 634 ttttttatta AAAAAC agcatggagt 639 0.692521 10-1 746 taccccatag AGAAGA tctttcggtt 751 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 365 370 367 -w 0.166205 >2 406 411 408 -w 1.634349 >3 237 242 239 -w 1.385042 >4 40 45 42 -w 0.387812 >5 666 671 668 -w 0.304709 >6 712 717 714 -w 0.415512 >7 438 443 440 -w 2.354571 >8 287 292 289 -w 2.354571 >9 634 639 636 -w 0.692521 >10 746 751 748 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 . . 65 . 1.0 3 94 . . . 1.3 4 66 . . . 0.5 5 39 . . . 0.1 6 . 38 . 48 0.4 non- site 30 . . . site 58 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 . . 12 . 10 3 15 . . . 13 4 7 . . . 5 5 1 . . . 1 6 . 4 . 3 4 site 5 . . . 3 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.518867 0.018125 0.434599 0.028409 0.779500 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.715291 0.018125 0.051824 0.214760 0.603717 5 0.377845 0.033235 0.258321 0.330600 0.186138 6 0.055508 0.635098 0.016568 0.292826 0.840106 Conservedness in bits: 4.998949 Conservedness in prob: 7.883993 Concensus sequence: AGAAGC Complete log-likelihood ratio = 54 bits Missing position information = 51 bits Log-likelihood ratio statistic = 2 bits Degrees of freedom = 18 Information per parameter = 0.128 bits MOTIF C 1-1 122 gcttccgaag TTTTGA tcaagcaagt 127 0.166205 2-1 547 tccttcacta TTTTAA catgtggaat 552 1.634349 3-1 243 cggtAGAATC TTTTCA caaaaggtac 248 1.385042 4-1 701 taactttttt TTTTGA acctgaatat 706 0.387812 5-1 260 attttttttt TTTTAA atttcacttt 265 0.304709 6-1 350 atttcgttac TTTTGA tatcactcac 355 0.415512 7-1 782 aagtaagaat TTTTGA aaATTCAAta 787 2.354571 8-1 702 actttcaaca TTTTCA gtttgtatta 707 2.354571 9-1 599 ttctcaaact TTGTAA tgcgcctgta 604 0.692521 10-1 117 tatgataatg TTTTCA atgtaagaga 122 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 122 127 124 -w 0.166205 >2 547 552 549 -w 1.634349 >3 243 248 245 -w 1.385042 >4 701 706 703 -w 0.387812 >5 260 265 262 -w 0.304709 >6 350 355 352 -w 0.415512 >7 782 787 784 -w 2.354571 >8 702 707 704 -w 2.354571 >9 599 604 601 -w 0.692521 >10 117 122 119 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 3 . . . 85 1.0 4 . . . 94 1.3 5 . 29 38 . 0.5 6 94 . . . 1.3 non- site . . . 31 site . . . 65 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 3 . . . 12 10 4 . . . 15 13 5 . 2 4 . 5 6 15 . . . 13 site . . . 7 4 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.079525 0.874544 1.044367 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.267041 0.385791 0.318759 0.028409 0.473908 6 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.622084 Conservedness in prob: 8.806844 Concensus sequence: TTTTCA Complete log-likelihood ratio = 86 bits Missing position information = 61 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.37 bits MOTIF D 1-1 281 ttggctgttg CCGTTGGTAAC gttgaaatgg 291 0.166205 2-1 171 ttgcaaacaa CCGCCGGCAGC ttagtatatA 181 1.634349 3-1 384 caggaaggca CCGGCGGTCTT tcgtCCGTGC 394 1.385042 4-1 628 tcttcattta CCGGCGCACTC tcgcccgaac 638 0.387812 5-1 420 agttataaca CCGGCGAACAA tcggggcaga 430 0.304709 6-1 329 atagcacgag CCGCGGAGTTC atttcgttac 339 0.415512 7-1 546 ggagagtctt CCGTCGGAGGG ctgtcgcccg 556 2.354571 8-1 607 agccttattt CTGGGGTAATT aatcagcgaa 617 2.354571 9-1 93 tattagggag CCGCCGGTACT aataacatca 103 0.692521 10-1 368 tttttttttt CCGGGGACTCT acgagaaccc 378 0.304709 sites: *** ** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 281 291 286 -w 0.166205 >2 171 181 176 -w 1.634349 >3 384 394 389 -w 1.385042 >4 628 638 633 -w 0.387812 >5 420 430 425 -w 0.304709 >6 329 339 334 -w 0.415512 >7 546 556 551 -w 2.354571 >8 607 617 612 -w 2.354571 >9 93 103 98 -w 0.692521 >10 368 378 373 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 . 84 . . 1.4 3 . . 93 . 1.9 5 . 56 29 . 0.8 6 . . 93 . 1.9 11 . 38 . 39 0.2 non- site . 19 18 . site . 48 40 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 . 17 . . 14 3 . . 22 . 19 5 . 8 2 . 8 6 . . 22 . 19 11 . 4 . 1 2 site . 6 5 . 8 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.027807 0.713164 0.016568 0.242461 1.069052 3 0.027807 0.018125 0.925659 0.028409 1.913088 5 0.027807 0.632580 0.296095 0.043519 1.041066 6 0.027807 0.018125 0.925659 0.028409 1.913088 11 0.055508 0.254841 0.230620 0.459031 0.286532 Conservedness in bits: 8.027063 Conservedness in prob: 10.965793 Concensus sequence: CCGCGT Complete log-likelihood ratio = 99 bits Missing position information = 82 bits Log-likelihood ratio statistic = 16 bits Degrees of freedom = 18 Information per parameter = 0.939 bits MOTIF E 1-1 545 tttttgggcc CGGAAT atatcttttc 550 0.166205 2-1 655 aaaattttta CTGAAA cgtatataat 660 1.634349 3-1 271 aacgtcaatt CGGAAA gCTTCCTTCC 276 1.385042 4-1 441 actgctgcta CGGAAA accaacctaa 446 0.387812 5-1 759 tcttagcaag CTAAAA tttggacagc 764 0.304709 6-1 728 aaaagcaggt CGGAAA tatttatggg 733 0.415512 7-1 225 GTAatacaaa CTGAAA atgttgaaag 230 2.354571 8-1 430 ggtcgcgttc CTGAAA cgcagatgtg 435 2.354571 9-1 161 tattgtaaag CGGAAA aaaagttatC 166 0.692521 10-1 530 tttcctagac CGGAAA aaagtcgtat 535 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 545 550 547 -w 0.166205 >2 655 660 657 -w 1.634349 >3 271 276 273 -w 1.385042 >4 441 446 443 -w 0.387812 >5 759 764 761 -w 0.304709 >6 728 733 730 -w 0.415512 >7 225 230 227 -w 2.354571 >8 430 435 432 -w 2.354571 >9 161 166 163 -w 0.692521 >10 530 535 532 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 . . 56 39 0.9 3 . . 83 . 1.5 4 94 . . . 1.3 5 94 . . . 1.3 6 85 . . . 1.0 non- site 30 . 18 . site 50 . 25 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 . . 9 1 9 3 . . 18 . 15 4 15 . . . 13 5 15 . . . 13 6 12 . . . 10 site 4 . 1 . 3 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.027807 0.018125 0.321277 0.632791 0.747975 3 0.055508 0.018125 0.897958 0.028409 1.768308 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.921788 0.018125 0.016568 0.043519 1.223227 Conservedness in bits: 8.133235 Conservedness in prob: 10.357415 Concensus sequence: CTGAAA Complete log-likelihood ratio = 96 bits Missing position information = 72 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.34 bits MOTIF F 1-1 651 gtaggaaatc ACTTAGAACT tgccttactt 660 0.166205 2-1 191 Cttagtatat AAATACACAT gtacataCCT 200 1.634349 3-1 69 agaaggcaca TCTATTACAT ttactgagca 78 1.385042 4-1 257 ggcaaggttg GCCTCTACTT actccatcga 266 0.387812 5-1 523 agaaaggggt AGAATCAATC tagcacgcag 532 0.304709 6-1 758 attatgcaga GCATCAACAT gataAAAAAA 767 0.415512 7-1 145 tagttttttc TCCTTGACGT taaagtatag 154 2.354571 8-1 773 atacctctat ACTTTAACGT caaggagaaa 782 2.354571 9-1 136 gccgagactt ACTTGGACTT ttctctattg 145 0.692521 10-1 253 gtacgtgggg CAGTTGACGT cttatcatat 262 0.304709 sites: ** * ** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 651 660 655 -w 0.166205 >2 191 200 195 -w 1.634349 >3 69 78 73 -w 1.385042 >4 257 266 261 -w 0.387812 >5 523 532 527 -w 0.304709 >6 758 767 762 -w 0.415512 >7 145 154 149 -w 2.354571 >8 773 782 777 -w 2.354571 >9 136 145 140 -w 0.692521 >10 253 262 257 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 48 . . . 0.1 2 . 65 . . 0.8 4 . . . 76 0.7 7 94 . . . 1.3 8 . 75 . . 1.1 10 . . . 85 1.0 non- site 30 19 . . site 35 28 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 3 . . . 1 2 . 11 . . 8 4 . . . 10 7 7 15 . . . 13 8 . 14 . . 11 10 . . . 12 10 site 1 1 . . 1 Weighted motif model: POS A C G T Prob 1 0.496203 0.045826 0.089598 0.368374 0.244773 2 0.204085 0.723237 0.044269 0.028409 1.036690 4 0.181421 0.018125 0.016568 0.783886 0.783313 7 0.936898 0.018125 0.016568 0.028409 1.294744 8 0.070617 0.884406 0.016568 0.028409 1.595845 10 0.027807 0.045826 0.016568 0.909799 1.151910 Conservedness in bits: 6.107275 Conservedness in prob: 9.189625 Concensus sequence: ACTACT Complete log-likelihood ratio = 60 bits Missing position information = 59 bits Log-likelihood ratio statistic = 0 bits Degrees of freedom = 18 Information per parameter = 0.0496 bits MOTIF G 1-1 252 tcaagttcca ATTGAA gaaggtcttg 257 0.166205 2-1 710 ttgttaccac ATTGAC aaccccaggt 715 1.634349 3-1 726 tatgcacctt ATTCAA ttatcatcaa 731 1.385042 4-1 279 tccatcgaca ATTCAA gatacagaac 284 0.387812 5-1 578 cctatcaggc ATTCAC ccgtgtgacg 583 0.304709 6-1 277 gacatcaaaa ATTGAA aatctatgga 282 0.415512 7-1 790 atTTTTGAaa ATTCAA tataa 795 2.354571 8-1 724 attacttctt ATTCAA atgtcataaa 729 2.354571 9-1 488 tctacccctt ATTCAA gtgccttttt 493 0.692521 10-1 721 cctttcttaa TTTCAC tctaaagcat 726 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 252 257 254 -w 0.166205 >2 710 715 712 -w 1.634349 >3 726 731 728 -w 1.385042 >4 279 284 281 -w 0.387812 >5 578 583 580 -w 0.304709 >6 277 282 279 -w 0.415512 >7 790 795 792 -w 2.354571 >8 724 729 726 -w 2.354571 >9 488 493 490 -w 0.692521 >10 721 726 723 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 2 . . . 94 1.3 3 . . . 94 1.3 4 . 65 29 . 1.1 5 94 . . . 1.3 6 66 29 . . 0.7 non- site 30 . . 31 site 43 . . 35 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 2 . . . 15 13 3 . . . 15 13 4 . 11 2 . 11 5 15 . . . 13 6 7 2 . . 7 site 2 . . 1 1 Weighted motif model: POS A C G T Prob 1 0.909197 0.018125 0.016568 0.056110 1.169907 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.725755 0.218029 0.028409 1.214714 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.732919 0.222104 0.016568 0.028409 0.802996 Conservedness in bits: 7.021737 Conservedness in prob: 9.481235 Concensus sequence: ATTCAA Complete log-likelihood ratio = 86 bits Missing position information = 67 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.07 bits MOTIF H 1-1 730 tcagttcaac CATACC tgctattata 735 0.166205 2-1 69 tgacttttac CATTTC accgcaatgg 74 1.634349 3-1 616 aaAAAACAAA CATTTC gcaggctaaa 621 1.385042 4-1 727 atatacatca CATATC actgctggtc 732 0.387812 5-1 499 atagcaaggt CATTTC gccttctcag 504 0.304709 6-1 118 cactctatat CTTTTA gttcttaatt 123 0.415512 7-1 673 gggctcttta CATTTC cacaacatat 678 2.354571 8-1 24 acaacacagt CATATC cattctcaat 29 2.354571 9-1 435 aatacgagtc CATTTC tccagtgaaa 440 0.692521 10-1 646 tgcccttttc CATTTT ccattaaatc 651 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 730 735 732 -w 0.166205 >2 69 74 71 -w 1.634349 >3 616 621 618 -w 1.385042 >4 727 732 729 -w 0.387812 >5 499 504 501 -w 0.304709 >6 118 123 120 -w 0.415512 >7 673 678 675 -w 2.354571 >8 24 29 26 -w 2.354571 >9 435 440 437 -w 0.692521 >10 646 651 648 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 85 . . . 1.0 3 . . . 94 1.3 4 . . . 66 0.6 5 . . . 85 1.0 6 . 75 . . 1.0 non- site . 19 . 31 site . 31 . 46 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 12 . . . 10 3 . . . 15 13 4 . . . 7 6 5 . . . 12 10 6 . 14 . . 10 site . 2 . 3 4 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.899124 0.018125 0.016568 0.066183 1.130433 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.292224 0.018125 0.016568 0.673083 0.605788 5 0.027807 0.033235 0.016568 0.922390 1.200918 6 0.065581 0.861741 0.016568 0.056110 1.477775 Conservedness in bits: 7.488838 Conservedness in prob: 10.138181 Concensus sequence: CATTTC Complete log-likelihood ratio = 82 bits Missing position information = 61 bits Log-likelihood ratio statistic = 21 bits Degrees of freedom = 18 Information per parameter = 1.19 bits MOTIF I 1-1 64 gttgaacaag AACAAGAA gttaatcaag 71 0.166205 2-1 569 gaattcttga AAGAATGA aatcgccatg 576 1.634349 3-1 608 tattgttcaa AAAACAAA CATTTCgcag 615 1.385042 4-1 598 taattctaat ATTAATAA tatcctatat 605 0.387812 5-1 455 tccggggaag AACAAGGA agggcggtct 462 0.304709 6-1 772 CAACATgata AAAAAAAA cagttgaata 779 0.415512 7-1 210 acatttgaat AAGAAGTA atacaaaCTG 217 2.354571 8-1 189 aaagaagttt AATAATCA tattacatgg 196 2.354571 9-1 551 ctccattaag AAAAAAAA tttatataac 558 0.692521 10-1 498 agaagatagg AAAAAAAA aaagctttca 505 0.304709 sites: ** ** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 64 71 67 -w 0.166205 >2 569 576 572 -w 1.634349 >3 608 615 611 -w 1.385042 >4 598 605 601 -w 0.387812 >5 455 462 458 -w 0.304709 >6 772 779 775 -w 0.415512 >7 210 217 213 -w 2.354571 >8 189 196 192 -w 2.354571 >9 551 558 554 -w 0.692521 >10 498 505 501 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 85 . . . 1.0 4 94 . . . 1.3 5 85 . . . 1.0 7 57 . . . 0.3 8 94 . . . 1.3 non- site 30 . . . site 90 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 12 . . . 10 4 15 . . . 13 5 12 . . . 10 7 5 . . . 3 8 15 . . . 13 site 14 . . . 11 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.901642 0.018125 0.016568 0.063665 1.140065 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.810985 0.144038 0.016568 0.028409 0.917684 7 0.332516 0.232177 0.192846 0.242461 0.018038 8 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 5.960020 Conservedness in prob: 8.030933 Concensus sequence: AAAACA Complete log-likelihood ratio = 77 bits Missing position information = 55 bits Log-likelihood ratio statistic = 21 bits Degrees of freedom = 18 Information per parameter = 1.21 bits MOTIF J 1-1 775 tataggtatt CCATGCG caaatagatt 781 0.166205 2-1 466 gttgcctcat CAATGCG agatccgttt 472 1.634349 3-1 399 GGTCTTtcgt CCGTGCG gagatatctg 405 1.385042 4-1 151 acgatcatcg TAGTGCC caattgggtg 157 0.387812 5-1 678 AATTgcttta CTGGGCG tataaaaccg 684 0.304709 6-1 522 agctatactt CGGAGCA ctgttgagcg 528 0.415512 7-1 473 ttgttcggag CAGTGCG gcgcgaggca 479 2.354571 8-1 399 agactctcct CCGTGCG tcctcgtctt 405 2.354571 9-1 346 gaaatggagt CCGTGCG agttttgtta 352 0.692521 10-1 190 tgctttcaac CGCTGCG ttttggatac 196 0.304709 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 775 781 778 -w 0.166205 >2 466 472 469 -w 1.634349 >3 399 405 402 -w 1.385042 >4 151 157 154 -w 0.387812 >5 678 684 681 -w 0.304709 >6 522 528 525 -w 0.415512 >7 473 479 476 -w 2.354571 >8 399 405 402 -w 2.354571 >9 346 352 349 -w 0.692521 >10 190 196 193 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.4 3 . . 65 . 0.9 4 . . . 76 0.7 5 . . 93 . 1.9 6 . 93 . . 1.8 7 . . 74 . 1.2 non- site . 19 18 . site . 35 43 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 14 3 . . 12 . 9 4 . . . 10 7 5 . . 22 . 19 6 . 21 . . 18 7 . . 15 . 12 site . 3 5 . 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.891960 0.016568 0.063665 1.628326 3 0.191494 0.045826 0.734272 0.028409 1.151306 4 0.065581 0.018125 0.044269 0.872025 0.992272 5 0.027807 0.018125 0.925659 0.028409 1.913088 6 0.027807 0.927216 0.016568 0.028409 1.804236 7 0.065581 0.053381 0.852630 0.028409 1.552499 Conservedness in bits: 9.041728 Conservedness in prob: 12.440387 Concensus sequence: CGTGCG Complete log-likelihood ratio = 96 bits Missing position information = 76 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.14 bits seed 5 time: 7 seconds (0.12 minutes) MOTIF A 1-1 25 ttgcggtgtt GACGCTA tgtccgtcga 31 0.166205 2-1 526 tccactgtgt GCCGAAC atgctccttc 532 1.634349 3-1 180 atatcaggta GCCGCAC tcaacttgTA 186 1.385042 4-1 630 ttcatttacc GGCGCAC tctcgcccga 636 0.387812 5-1 422 ttataacacc GGCGAAC aatcggggca 428 0.304709 6-1 523 gctatacttc GGAGCAC tgttgagcga 529 0.415512 7-1 526 tgaagacgag GACGCAC ggaggagagt 532 2.354571 8-1 452 tgtgcctcgc GCCGCAC tgctccgaac 458 2.354571 9-1 371 taGGATGAct GCCCCAC acatttcctc 377 0.692521 10-1 317 caactgacga GATGCAG taaaaagaga 323 0.304709 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 25 31 28 -w 0.166205 >2 526 532 529 -w 1.634349 >3 180 186 183 -w 1.385042 >4 630 636 633 -w 0.387812 >5 422 428 425 -w 0.304709 >6 523 529 526 -w 0.415512 >7 526 532 529 -w 2.354571 >8 452 458 455 -w 2.354571 >9 371 377 374 -w 0.692521 >10 317 323 320 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 93 . 1.9 3 . 75 . . 1.0 4 . . 83 . 1.5 5 . 75 . . 1.1 6 85 . . . 1.0 7 . 75 . . 1.1 non- site . 19 18 . site . 41 33 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 22 . 19 3 . 14 . . 10 4 . . 18 . 15 5 . 14 . . 11 6 12 . . . 10 7 . 14 . . 11 site . 4 3 . 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.925659 0.028409 1.913088 3 0.065581 0.861741 0.016568 0.056110 1.477775 4 0.027807 0.081081 0.862703 0.028409 1.635272 5 0.204085 0.750938 0.016568 0.028409 1.161966 6 0.921788 0.018125 0.016568 0.043519 1.223227 7 0.042916 0.884406 0.044269 0.028409 1.590532 Conservedness in bits: 9.001860 Conservedness in prob: 12.353203 Concensus sequence: GCGCAC Complete log-likelihood ratio = 92 bits Missing position information = 72 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.12 bits MOTIF B 1-1 403 tgttaagtcc TCCATG ggtccagctt 408 0.166205 2-1 581 gaatgaaatc GCCATG ccaagccatc 586 1.634349 3-1 398 cGGTCTTTcg TCCGTG cggagatatc 403 1.385042 4-1 116 ggccgcctct GCCATG gcaaaGAATG 121 0.387812 5-1 445 ggcagactat TCCGGG gAAGAACAAG 450 0.304709 6-1 477 attttgttca TACATT cttaaattgc 482 0.415512 7-1 726 tggtggtaat GCCATG taatatgatt 731 2.354571 8-1 398 aagactctcc TCCGTG cgtcctcgtc 403 2.354571 9-1 496 ttattcaagt GCCTTT tttttttttt 501 0.692521 10-1 644 tttgcccttt TCCATT ttccattaaa 649 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 403 408 405 -w 0.166205 >2 581 586 583 -w 1.634349 >3 398 403 400 -w 1.385042 >4 116 121 118 -w 0.387812 >5 445 450 447 -w 0.304709 >6 477 482 479 -w 0.415512 >7 726 731 728 -w 2.354571 >8 398 403 400 -w 2.354571 >9 496 501 498 -w 0.692521 >10 644 649 646 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 38 57 0.7 2 . 84 . . 1.4 3 . 93 . . 1.8 4 57 . 29 . 0.5 5 . . . 85 1.0 6 . . 65 . 1.0 non- site . 19 18 . site . 31 25 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 4 5 7 2 . 17 . . 14 3 . 21 . . 18 4 5 . 2 . 5 5 . . . 12 10 6 . . 12 . 10 site . 2 1 . 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.477409 0.476659 0.794704 2 0.065581 0.889442 0.016568 0.028409 1.617607 3 0.027807 0.927216 0.016568 0.028409 1.804236 4 0.506276 0.018125 0.384234 0.091366 0.556717 5 0.027807 0.018125 0.044269 0.909799 1.153355 6 0.027807 0.018125 0.797228 0.156840 1.382472 Conservedness in bits: 7.309090 Conservedness in prob: 10.510976 Concensus sequence: GCCGTG Complete log-likelihood ratio = 81 bits Missing position information = 68 bits Log-likelihood ratio statistic = 12 bits Degrees of freedom = 18 Information per parameter = 0.707 bits MOTIF C 1-1 449 ccgagcgatt AATACATATCT ccatcttttt 459 0.166205 2-1 184 ccggcagctt AGTATATAAAT acacatgtac 194 1.634349 3-1 640 aaatgtggag ATAGGATAAGT tttgTAGACA 650 1.385042 4-1 450 acggaaaacc AACCTAAAGGT attaacttct 460 0.387812 5-1 756 gcatcttagc AAGCTAAAATT tggacagctc 766 0.304709 6-1 268 caccatggag ACATCAAAAAT tgaaaatcta 278 0.415512 7-1 289 Atctgttaat AGATCAAAAAT catcgcttcg 299 2.354571 8-1 746 taaaagtatc AACAAAAAATT gttaatatac 756 2.354571 9-1 388 acatttcctc ATCTTATAATT ttgtggaaaa 398 0.692521 10-1 779 attcctacgc ATAATAAGAAT aggagggaat 789 0.304709 sites: * **** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 449 459 454 -w 0.166205 >2 184 194 189 -w 1.634349 >3 640 650 645 -w 1.385042 >4 450 460 455 -w 0.387812 >5 756 766 761 -w 0.304709 >6 268 278 273 -w 0.415512 >7 289 299 294 -w 2.354571 >8 746 756 751 -w 2.354571 >9 388 398 393 -w 0.692521 >10 779 789 784 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 6 94 . . . 1.3 7 57 . . 39 0.5 8 85 . . . 1.0 9 76 . . . 0.7 11 . . . 94 1.3 non- site 30 . . . site 71 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 6 15 . . . 13 7 5 . . 1 5 8 12 . . . 10 9 10 . . . 7 11 . . . 15 13 site 9 . . . 7 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.936898 0.018125 0.016568 0.028409 1.294744 7 0.584342 0.018125 0.016568 0.380965 0.534561 8 0.909197 0.018125 0.044269 0.028409 1.177581 9 0.886533 0.018125 0.051824 0.043519 1.080537 11 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.651856 Conservedness in prob: 8.855613 Concensus sequence: AAAAAT Complete log-likelihood ratio = 77 bits Missing position information = 59 bits Log-likelihood ratio statistic = 17 bits Degrees of freedom = 18 Information per parameter = 0.994 bits MOTIF D 1-1 646 gttttgtagg AAATCA cttagaactt 651 0.166205 2-1 6 atgct AAATCA tttggctttt 11 1.634349 3-1 228 aactccaatt AAATGC ggtagaatct 233 1.385042 4-1 127 CCATGgcaaa GAATGC tttccatgac 132 0.387812 5-1 524 gaaaggggta GAATCA atctagcacg 529 0.304709 6-1 392 ttcagtgaaa AAATCA taaggaaaag 397 0.415512 7-1 116 cacttcttct GAATGA gatttagtca 121 2.354571 8-1 553 TCAAATTAAC GAATCA aattaacaac 558 2.354571 9-1 363 agttttgtta GGATGA ctGCCCCACa 368 0.692521 10-1 462 ggaggaaaag AAATGA cagaaaaatt 467 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 646 651 648 -w 0.166205 >2 6 11 8 -w 1.634349 >3 228 233 230 -w 1.385042 >4 127 132 129 -w 0.387812 >5 524 529 526 -w 0.304709 >6 392 397 394 -w 0.415512 >7 116 121 118 -w 2.354571 >8 553 558 555 -w 2.354571 >9 363 368 365 -w 0.692521 >10 462 467 464 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 48 . 47 . 0.8 2 85 . . . 1.0 3 94 . . . 1.3 4 . . . 94 1.3 5 . 47 47 . 1.0 6 76 . . . 0.8 non- site 30 . . . site 53 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 3 . 6 . 8 2 12 . . . 10 3 15 . . . 13 4 . . . 15 13 5 . 6 6 . 10 6 10 . . . 8 site 4 . . . 2 Weighted motif model: POS A C G T Prob 1 0.382881 0.018125 0.570585 0.028409 0.902535 2 0.873941 0.018125 0.079525 0.028409 1.067538 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.461338 0.482446 0.028409 1.041471 6 0.775729 0.179293 0.016568 0.028409 0.858446 Conservedness in bits: 6.434423 Conservedness in prob: 9.108088 Concensus sequence: GAATGA Complete log-likelihood ratio = 82 bits Missing position information = 61 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.14 bits MOTIF E 1-1 604 cttactccat ATCATGCCA tttttctttc 612 0.166205 2-1 339 gtaatatcaa ACAGTGACA catattaaac 347 1.634349 3-1 195 ACtcaacttg TAACTGGCA actactttgc 203 1.385042 4-1 351 gacccaatat TGACTGCCA ctggacctga 359 0.387812 5-1 481 cttttctccc TCATTGTCA tagcaaggtc 489 0.304709 6-1 737 tcggaaatat TTATGGGCA ttattatgca 745 0.415512 7-1 408 tggggccagg TTACTGCCA attTTTCCTC 416 2.354571 8-1 200 ataatcatat TACATGGCA ttaccaccat 208 2.354571 9-1 12 agctctatgt ACATTGCCA aGGTTTTCta 20 0.692521 10-1 292 atttgcgaag TTCTTGGCA agttgccaac 300 0.304709 sites: * * ** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 604 612 608 -w 0.166205 >2 339 347 343 -w 1.634349 >3 195 203 199 -w 1.385042 >4 351 359 355 -w 0.387812 >5 481 489 485 -w 0.304709 >6 737 745 741 -w 0.415512 >7 408 416 412 -w 2.354571 >8 200 208 204 -w 2.354571 >9 12 20 16 -w 0.692521 >10 292 300 296 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 66 0.6 3 66 29 . . 0.7 5 . . . 85 1.0 6 . . 93 . 1.9 8 . 93 . . 1.8 9 94 . . . 1.3 non- site . . . . site . . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 7 6 3 7 2 . . 7 5 . . . 12 10 6 . . 22 . 19 8 . 21 . . 18 9 15 . . . 13 site . . . . 0 Weighted motif model: POS A C G T Prob 1 0.254450 0.018125 0.016568 0.710857 0.655275 3 0.680035 0.274987 0.016568 0.028409 0.755820 5 0.027807 0.018125 0.054342 0.899726 1.118882 6 0.027807 0.018125 0.925659 0.028409 1.913088 8 0.027807 0.927216 0.016568 0.028409 1.804236 9 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 7.542045 Conservedness in prob: 10.040933 Concensus sequence: TATGCA Complete log-likelihood ratio = 95 bits Missing position information = 67 bits Log-likelihood ratio statistic = 27 bits Degrees of freedom = 18 Information per parameter = 1.53 bits MOTIF F 1-1 623 tttttctttc CTTTCTC agcgatgttt 629 0.166205 2-1 457 ataattagcg TTGCCTC atcaatgcga 463 1.634349 3-1 368 aaaggggcgg TTGCCTC aggaaggcac 374 1.385042 4-1 294 agatacagaa CCTCCTC cagatggaat 300 0.387812 5-1 383 tgtcaacaaa CTTCCTA tggagtgtat 389 0.304709 6-1 84 gatttgccag CTTACTA tccttctTGA 90 0.415512 7-1 420 ACTGCCAatt TTTCCTC ttcataacca 426 2.354571 8-1 279 cccattatct TAGCCTA aaaaaacctt 285 2.354571 9-1 186 caccccgccc CCTCCTC cgctcctcca 192 0.692521 10-1 520 ctttcaccga TTTCCTA gaccggaaaa 526 0.304709 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 623 629 626 -w 0.166205 >2 457 463 460 -w 1.634349 >3 368 374 371 -w 1.385042 >4 294 300 297 -w 0.387812 >5 383 389 386 -w 0.304709 >6 84 90 87 -w 0.415512 >7 420 426 423 -w 2.354571 >8 279 285 282 -w 2.354571 >9 186 192 189 -w 0.692521 >10 520 526 523 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 47 . 48 0.7 3 . . 29 66 0.8 4 . 75 . . 1.0 5 . 93 . . 1.8 6 . . . 94 1.3 7 39 56 . . 0.8 non- site . 19 . 31 site . 48 . 38 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 6 . 3 7 3 . . 2 7 8 4 . 14 . . 10 5 . 21 . . 18 6 . . . 15 13 7 1 8 . . 8 site . 6 . 1 5 Weighted motif model: POS A C G T Prob 1 0.027807 0.196921 0.016568 0.758704 0.813868 3 0.027807 0.018125 0.505110 0.448958 0.818638 4 0.065581 0.874333 0.016568 0.043519 1.537903 5 0.027807 0.927216 0.016568 0.028409 1.804236 6 0.027807 0.018125 0.016568 0.937500 1.269688 7 0.335034 0.619989 0.016568 0.028409 0.903187 Conservedness in bits: 7.147520 Conservedness in prob: 10.322197 Concensus sequence: TGCCTC Complete log-likelihood ratio = 77 bits Missing position information = 65 bits Log-likelihood ratio statistic = 11 bits Degrees of freedom = 18 Information per parameter = 0.655 bits MOTIF G 1-1 61 gaagttgaac AAGAACAAGAA gttaatcaag 71 0.166205 2-1 769 AAAAAGAGAa AATAAAAGTAA aaaggtaggg 779 1.634349 3-1 740 aattatcatc AAGAATAGTAA tagttaagta 750 1.385042 4-1 324 ttccatagag AGAAGGAGCAA gcaactgacc 334 0.387812 5-1 452 tatTCCGGGg AAGAACAAGGA agggcggtct 462 0.304709 6-1 307 tatggacggt AGCAACAAGAA tatagcacga 317 0.415512 7-1 214 ttgaataaga AGTAATACAAA ctgaaaatgt 224 2.354571 8-1 788 aacgtcaagg AGAAAAAACTA ta 798 2.354571 9-1 748 aaccacaagc AGCAATACAAA gagaatttta 758 0.692521 10-1 495 acaagaagat AGGAAAAAAAA aaagctttca 505 0.304709 sites: ** ** * * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 61 71 66 -w 0.166205 >2 769 779 774 -w 1.634349 >3 740 750 745 -w 1.385042 >4 324 334 329 -w 0.387812 >5 452 462 457 -w 0.304709 >6 307 317 312 -w 0.415512 >7 214 224 219 -w 2.354571 >8 788 798 793 -w 2.354571 >9 748 758 753 -w 0.692521 >10 495 505 500 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 39 . 56 . 0.9 4 94 . . . 1.3 5 85 . . . 1.0 7 94 . . . 1.3 11 94 . . . 1.3 non- site 30 . . . site 88 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 1 . 9 . 9 4 15 . . . 13 5 12 . . . 10 7 15 . . . 13 11 15 . . . 13 site 14 . . . 13 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.345107 0.018125 0.608359 0.028409 0.957040 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.901642 0.018125 0.051824 0.028409 1.151211 7 0.936898 0.018125 0.016568 0.028409 1.294744 11 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 7.287229 Conservedness in prob: 9.758414 Concensus sequence: AGAAAA Complete log-likelihood ratio = 93 bits Missing position information = 67 bits Log-likelihood ratio statistic = 25 bits Degrees of freedom = 18 Information per parameter = 1.41 bits MOTIF H 1-1 778 aggtattcca TGCGCAAATAGA ttacttgcaa 789 0.166205 2-1 756 gaatcaggag TGCAAAAAGAGA aAATAAAAGT 767 1.634349 3-1 655 ATAAGTtttg TAGACATATATA aacaatcagt 666 1.385042 4-1 710 tttttgaacc TGAATATATATA catcacatat 721 0.387812 5-1 788 cattactaaa TTAAGATAGAAA a 799 0.304709 6-1 98 CTAtccttct TGAAAATATGCA ctctatatcT 109 0.415512 7-1 268 atgcagcttt TCCATTTATATA tctgttaatA 279 2.354571 8-1 642 tGATTTTTga TCTATTAACAGA tatataaatg 653 2.354571 9-1 542 tgcctcaatc TCCATTAAGAAA aaaaatttat 553 0.692521 10-1 598 caggacaaat TGTAAAGATATA ataaactatt 609 0.304709 sites: * * * * * * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 778 789 783 -w 0.166205 >2 756 767 761 -w 1.634349 >3 655 666 660 -w 1.385042 >4 710 721 715 -w 0.387812 >5 788 799 793 -w 0.304709 >6 98 109 103 -w 0.415512 >7 268 279 273 -w 2.354571 >8 642 653 647 -w 2.354571 >9 542 553 547 -w 0.692521 >10 598 609 603 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 4 85 . . . 1.0 6 66 . . . 0.6 8 94 . . . 1.3 10 85 . . . 1.0 12 94 . . . 1.3 non- site 30 . . . site 75 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 4 12 . . . 10 6 7 . . . 6 8 15 . . . 13 10 12 . . . 10 12 15 . . . 13 site 10 . . . 8 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.921788 0.018125 0.031678 0.028409 1.226071 6 0.445838 0.018125 0.016568 0.519469 0.503194 8 0.936898 0.018125 0.016568 0.028409 1.294744 10 0.899124 0.018125 0.054342 0.028409 1.142806 12 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.731248 Conservedness in prob: 8.695114 Concensus sequence: TATAAA Complete log-likelihood ratio = 82 bits Missing position information = 68 bits Log-likelihood ratio statistic = 13 bits Degrees of freedom = 18 Information per parameter = 0.766 bits MOTIF I 1-1 735 tcaaccatac CTGCTATTATA taatcttcga 745 0.166205 2-1 65 gggttgactt TTACCATTTCA ccgcaatgga 75 1.634349 3-1 304 cttaagtagg TTGCAATTTCT ttttctatta 314 1.385042 4-1 66 ctcatgtctt TTGGGTTTGTC ttcaatacgg 76 0.387812 5-1 246 atgacctctg TTAAATTTTTT tttttttaaa 256 0.304709 6-1 119 Actctatatc TTTTAGTTCTT aattgcaaca 129 0.415512 7-1 669 aatggggctc TTTACATTTCC acaacatata 679 2.354571 8-1 542 cccacaaacc TTCAAATTAAC GAATCAaatt 552 2.354571 9-1 248 ctaaccagtt TTTCCGTTCCT tgaaacccag 258 0.692521 10-1 352 ttgaaacttt TTGTCCTTTTT tttttccggg 362 0.304709 sites: ** * ** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 735 745 740 -w 0.166205 >2 65 75 70 -w 1.634349 >3 304 314 309 -w 1.385042 >4 66 76 71 -w 0.387812 >5 246 256 251 -w 0.304709 >6 119 129 124 -w 0.415512 >7 669 679 674 -w 2.354571 >8 542 552 547 -w 2.354571 >9 248 258 253 -w 0.692521 >10 352 362 357 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 1.0 2 . . . 94 1.3 5 39 38 . . 0.2 7 . . . 94 1.3 8 . . . 94 1.3 11 . 29 . 48 0.3 non- site . . . 31 site . . . 75 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 10 2 . . . 15 13 5 1 4 . . 2 7 . . . 15 13 8 . . . 15 13 11 . 2 . 3 3 site . . . 9 7 Weighted motif model: POS A C G T Prob 1 0.027807 0.033235 0.016568 0.922390 1.200918 2 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.433246 0.471411 0.051824 0.043519 0.585060 7 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.027807 0.018125 0.016568 0.937500 1.269688 11 0.191494 0.481484 0.016568 0.310454 0.422810 Conservedness in bits: 6.017851 Conservedness in prob: 8.829915 Concensus sequence: TTCTTC Complete log-likelihood ratio = 65 bits Missing position information = 52 bits Log-likelihood ratio statistic = 12 bits Degrees of freedom = 18 Information per parameter = 0.7 bits MOTIF J 1-1 476 ttttaaatac CTTTTTT aatacgtatg 482 0.166205 2-1 601 gccatcacac GGTCTTT tatgcaattg 607 1.634349 3-1 389 aggcaccggc GGTCTTT cgTCCGTGcg 395 1.385042 4-1 783 ttggtttccc GTTCTTT ccactcccgt 789 0.387812 5-1 146 agttatttgg GCTCTTT gctcgaggtt 152 0.304709 6-1 168 cgaattttat GCTATTT tttaaatttg 174 0.415512 7-1 137 agtcattata GTTTTTT ctccttgacg 143 2.354571 8-1 633 gcgaagcgat GATTTTT gaTCTATTAA 639 2.354571 9-1 22 ACATTGCCAa GGTTTTC tactgatcaa 28 0.692521 10-1 750 ccatagagaa GATCTTT cggttcgaag 756 0.304709 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 476 482 479 -w 0.166205 >2 601 607 604 -w 1.634349 >3 389 395 392 -w 1.385042 >4 783 789 786 -w 0.387812 >5 146 152 149 -w 0.304709 >6 168 174 171 -w 0.415512 >7 137 143 140 -w 2.354571 >8 633 639 636 -w 2.354571 >9 22 28 25 -w 0.692521 >10 750 756 753 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 83 . 1.5 3 . . . 94 1.3 4 . 47 . 39 0.5 5 . . . 94 1.3 6 . . . 94 1.3 7 . . . 85 1.0 non- site . . . 31 site . . . 71 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 18 . 15 3 . . . 15 13 4 . 6 . 1 5 5 . . . 15 13 6 . . . 15 13 7 . . . 12 10 site . . . 9 7 Weighted motif model: POS A C G T Prob 1 0.027807 0.033235 0.910550 0.028409 1.832843 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.065581 0.383272 0.016568 0.534579 0.572427 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.018125 0.016568 0.937500 1.269688 7 0.027807 0.081081 0.016568 0.874544 1.039653 Conservedness in bits: 7.253987 Conservedness in prob: 9.503266 Concensus sequence: GTCTTT Complete log-likelihood ratio = 87 bits Missing position information = 64 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.26 bits seed 6 time: 7 seconds (0.12 minutes) MOTIF A 1-1 622 atttttcttt CCTTTC tCAGCGATgt 627 0.166205 2-1 368 acagtggttt CTTTGC ataaacacca 373 1.634349 3-1 208 ctggcaacta CTTTGC atcaaactcc 213 1.385042 4-1 742 cactgctggt CCTTGC cgaccagcgt 747 0.387812 5-1 149 tatttgggct CTTTGC tcgaggttac 154 0.304709 6-1 492 tcttaaattg CTTTGC ctctcctttt 497 0.415512 7-1 751 tattaaactt CTTTGC gtccatcCAA 756 2.354571 8-1 277 gccccattat CTTAGC ctaaaaaaac 282 2.354571 9-1 13 gctctatgta CATTGC caaggttttc 18 0.692521 10-1 190 tgctttcaac CGCTGC gttttggata 195 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 622 627 624 -w 0.166205 >2 368 373 370 -w 1.634349 >3 208 213 210 -w 1.385042 >4 742 747 744 -w 0.387812 >5 149 154 151 -w 0.304709 >6 492 497 494 -w 0.415512 >7 751 756 753 -w 2.354571 >8 277 282 279 -w 2.354571 >9 13 18 15 -w 0.692521 >10 190 195 192 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 . . . 57 0.3 3 . . . 85 1.0 4 . . . 85 0.9 5 . . 83 . 1.5 6 . 93 . . 1.8 non- site . 19 . 31 site . 38 . 41 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 . . . 5 3 3 . . . 12 10 4 . . . 12 9 5 . . 18 . 15 6 . 21 . . 18 site . 4 . 2 4 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.090763 0.068490 0.044269 0.796478 0.720025 3 0.027807 0.045826 0.016568 0.909799 1.151910 4 0.241859 0.018125 0.016568 0.723448 0.674165 5 0.027807 0.018125 0.910550 0.043519 1.830549 6 0.027807 0.927216 0.016568 0.028409 1.804236 Conservedness in bits: 7.985121 Conservedness in prob: 10.858163 Concensus sequence: CTTTGC Complete log-likelihood ratio = 87 bits Missing position information = 69 bits Log-likelihood ratio statistic = 18 bits Degrees of freedom = 18 Information per parameter = 1.03 bits MOTIF B 1-1 629 tttCCTTTCt CAGCGAT gttttgtagg 635 0.166205 2-1 327 tctacgctga CAGTAAT atcaaacagt 333 1.634349 3-1 150 attcagatca CAGCAAT ataggactag 156 1.385042 4-1 39 aagatgcttt CAGAGAT ggtgcttatc 45 0.387812 5-1 285 tctaaagtcc CAGAAAT CCGCTTGAAt 291 0.304709 6-1 759 ttatgcagag CATCAAC atgATAAAAA 765 0.415512 7-1 764 TGCgtccatc CAAAAAA aaagtaagaa 770 2.354571 8-1 188 caaagaagtt TAATAAT catattacat 194 2.354571 9-1 75 gtatgcgtat TAGTAAA ctattaggga 81 0.692521 10-1 468 AAAGAAAtga CAGAAAA attCCGATGG 474 0.304709 sites: *** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 629 635 632 -w 0.166205 >2 327 333 330 -w 1.634349 >3 150 156 153 -w 1.385042 >4 39 45 42 -w 0.387812 >5 285 291 288 -w 0.304709 >6 759 765 762 -w 0.415512 >7 764 770 767 -w 2.354571 >8 188 194 191 -w 2.354571 >9 75 81 78 -w 0.692521 >10 468 474 471 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 75 . . 1.1 2 94 . . . 1.3 3 . . 65 . 0.9 5 76 . . . 0.8 6 94 . . . 1.3 7 . . . 57 0.3 non- site 30 . . . site 55 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 14 . . 11 2 15 . . . 13 3 . . 12 . 9 5 10 . . . 8 6 15 . . . 13 7 . . . 5 3 site 5 . . . 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.650208 0.016568 0.305417 0.945261 2 0.936898 0.018125 0.016568 0.028409 1.294744 3 0.455911 0.018125 0.459781 0.066183 0.665432 5 0.886533 0.018125 0.066933 0.028409 1.103324 6 0.936898 0.018125 0.016568 0.028409 1.294744 7 0.332516 0.055899 0.016568 0.595017 0.433009 Conservedness in bits: 5.736515 Conservedness in prob: 8.734650 Concensus sequence: CAGAAT Complete log-likelihood ratio = 70 bits Missing position information = 70 bits Log-likelihood ratio statistic = 0 bits Degrees of freedom = 18 Information per parameter = -0.00363 bits MOTIF C 1-1 753 atataatctt CGACTCGCA taatataggt 761 0.166205 2-1 624 attgattgac CGCCTGCAA cacataggca 632 1.634349 3-1 543 cattatactc CTGCTAGAA agttaactgt 551 1.385042 4-1 432 gtcactgcca CTGCTGCTA cggaaaacca 440 0.387812 5-1 292 tccCAGAAAT CCGCTTGAA tgtcttacat 300 0.304709 6-1 373 cacaactatt GCGAAGCGC ttcagtgaaa 381 0.415512 7-1 572 gcccgctcgg CGGCTTCTA atccgtactt 580 2.354571 8-1 458 tcgcgccgca CTGCTCCGA acaataaaga 466 2.354571 9-1 192 gccccctcct CCGCTCCTC cactaaaacg 200 0.692521 10-1 757 gaagatcttt CGGTTCGAA gacattccta 765 0.304709 sites: * *** * * 5 (10 sites in 10 sequences) Conservedness in sites: >1 753 761 757 -w 0.166205 >2 624 632 628 -w 1.634349 >3 543 551 547 -w 1.385042 >4 432 440 436 -w 0.387812 >5 292 300 296 -w 0.304709 >6 373 381 377 -w 0.415512 >7 572 580 576 -w 2.354571 >8 458 466 462 -w 2.354571 >9 192 200 196 -w 0.692521 >10 757 765 761 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.5 3 . . 74 . 1.2 4 . 75 . . 1.0 5 . . . 85 0.9 7 . 56 38 . 1.1 9 76 . . . 0.8 non- site . 19 18 . site . 43 21 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 15 3 . . 15 . 12 4 . 14 . . 10 5 . . . 12 9 7 . 8 4 . 11 9 10 . . . 8 site . 5 1 . 3 Weighted motif model: POS A C G T Prob 1 0.027807 0.889442 0.054342 0.028409 1.629552 3 0.042916 0.166702 0.761972 0.028409 1.309653 4 0.065581 0.861741 0.016568 0.056110 1.477775 5 0.065581 0.018125 0.016568 0.899726 1.106936 7 0.027807 0.730792 0.212992 0.028409 1.222909 9 0.836167 0.118855 0.016568 0.028409 0.968858 Conservedness in bits: 7.715685 Conservedness in prob: 11.183462 Concensus sequence: CGCTCA Complete log-likelihood ratio = 77 bits Missing position information = 68 bits Log-likelihood ratio statistic = 9 bits Degrees of freedom = 18 Information per parameter = 0.535 bits MOTIF D 1-1 542 ataTTTTTGg GCCCGGAATA tatcttttcg 551 0.166205 2-1 524 ggtccactgt GTGCCGAACA tgctccttca 533 1.634349 3-1 470 ggcagtatcg GGGCGGATCA ctccgaaccg 479 1.385042 4-1 324 ttccatagag AGAAGGAGCA agcaactgac 333 0.387812 5-1 680 ttgctttact GGGCGTATAA aaccgggaga 689 0.304709 6-1 606 tccaaaaagc GCTCGGACAA ctgttgaccg 615 0.415512 7-1 465 aatctttatt GTTCGGAGCA gtgcggcgcg 474 2.354571 8-1 345 ctatattgaa GTACGGATTA gaagccgccg 354 2.354571 9-1 329 cgggaaaaag GTCCGGGGAA atggagtccg 338 0.692521 10-1 527 cgatttccta GACCGGAAAA aagtcgtatg 536 0.304709 sites: * **** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 542 551 546 -w 0.166205 >2 524 533 528 -w 1.634349 >3 470 479 474 -w 1.385042 >4 324 333 328 -w 0.387812 >5 680 689 684 -w 0.304709 >6 606 615 610 -w 0.415512 >7 465 474 469 -w 2.354571 >8 345 354 349 -w 2.354571 >9 329 338 333 -w 0.692521 >10 527 536 531 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 83 . 1.5 4 . 84 . . 1.4 5 . . 83 . 1.5 6 . . 83 . 1.5 7 85 . . . 1.0 10 94 . . . 1.3 non- site 30 . 18 . site 35 . 46 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 18 . 15 4 . 17 . . 14 5 . . 18 . 15 6 . . 18 . 15 7 12 . . . 10 10 15 . . . 13 site 1 . 6 . 6 Weighted motif model: POS A C G T Prob 1 0.063062 0.018125 0.890403 0.028409 1.733081 4 0.063062 0.891960 0.016568 0.028409 1.628710 5 0.027807 0.166702 0.777082 0.028409 1.388251 6 0.027807 0.018125 0.897958 0.056110 1.768047 7 0.873941 0.018125 0.079525 0.028409 1.067538 10 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 8.880371 Conservedness in prob: 11.972456 Concensus sequence: GCGGAA Complete log-likelihood ratio = 104 bits Missing position information = 82 bits Log-likelihood ratio statistic = 21 bits Degrees of freedom = 18 Information per parameter = 1.18 bits MOTIF E 1-1 254 aagttccaat TGAAGAA ggtcttgtgt 260 0.166205 2-1 97 tcaaacttgt TGAAGAG aatgttcaca 103 1.634349 3-1 590 tacaacattc TGGAGAG ctaTTGTTCa 596 1.385042 4-1 99 gccgttgtct TGCAAAC ggccgcctct 105 0.387812 5-1 390 aaacttccta TGGAGTG tataagaatt 396 0.304709 6-1 707 tagtttggct AGCAAAG atataaaagc 713 0.415512 7-1 535 ggacgcacgg AGGAGAG tcttCCGTCG 541 2.354571 8-1 259 gttgtggaaa TGTAAAG agccccatta 265 2.354571 9-1 154 ttttctctat TGTAAAG cggaaaaAAA 160 0.692521 10-1 285 caaagtcatt TGCGAAG ttcttggcAA 291 0.304709 sites: ** **** 5 (10 sites in 10 sequences) Conservedness in sites: >1 254 260 257 -w 0.166205 >2 97 103 100 -w 1.634349 >3 590 596 593 -w 1.385042 >4 99 105 102 -w 0.387812 >5 390 396 393 -w 0.304709 >6 707 713 710 -w 0.415512 >7 535 541 538 -w 2.354571 >8 259 265 262 -w 2.354571 >9 154 160 157 -w 0.692521 >10 285 291 288 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 76 0.7 2 . . 93 . 1.9 4 85 . . . 1.0 5 48 . 47 . 0.8 6 85 . . . 1.0 7 . . 74 . 1.2 non- site 30 . 18 . site 43 . 40 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 10 7 2 . . 22 . 19 4 12 . . . 10 5 3 . 6 . 8 6 12 . . . 10 7 . . 15 . 12 site 2 . 5 . 5 Weighted motif model: POS A C G T Prob 1 0.279633 0.018125 0.016568 0.685674 0.621121 2 0.027807 0.018125 0.925659 0.028409 1.913088 4 0.909197 0.018125 0.044269 0.028409 1.177581 5 0.405545 0.018125 0.547920 0.028409 0.874167 6 0.909197 0.018125 0.016568 0.056110 1.169907 7 0.042916 0.053381 0.875294 0.028409 1.660175 Conservedness in bits: 7.416039 Conservedness in prob: 10.473427 Concensus sequence: TGAGAG Complete log-likelihood ratio = 81 bits Missing position information = 67 bits Log-likelihood ratio statistic = 13 bits Degrees of freedom = 18 Information per parameter = 0.744 bits MOTIF F 1-1 74 aacaagaagt TAATCAAGAAGTTGT ctaagaagta 88 0.166205 2-1 246 cTTGTATtta TCGTCTTTTCGCTGT aaaAACTTTA 260 1.634349 3-1 256 tcacaaaagg TACTCAACGTCAATT cggaaagctt 270 1.385042 4-1 704 ctttTTTTTT TGAACCTGAATATAT atacatcaca 718 0.387812 5-1 484 ttctccctca TTGTCATAGCAAGGT catttcgcct 498 0.304709 6-1 456 agggggtaat TTTTCCCCTTTATTT tgttcataca 470 0.415512 7-1 179 atattaacaa TTTTTTGTTGATACT tttatgacat 193 2.354571 8-1 744 cataaaagta TCAACAAAAAATTGT taatatacct 758 2.354571 9-1 438 acgagtccat TTCTCCAGTGAAACT accgtagaca 452 0.692521 10-1 648 cccttttcca TTTTCCATTAAATCT ctgttctctc 662 0.304709 sites: * *** * * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 74 88 81 -w 0.166205 >2 246 260 253 -w 1.634349 >3 256 270 263 -w 1.385042 >4 704 718 711 -w 0.387812 >5 484 498 491 -w 0.304709 >6 456 470 463 -w 0.415512 >7 179 193 186 -w 2.354571 >8 744 758 751 -w 2.354571 >9 438 452 445 -w 0.692521 >10 648 662 655 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 4 . . . 76 0.7 5 . 84 . . 1.4 6 39 38 . . 0.3 9 . . . 48 0.3 15 . . . 94 1.3 non- site . . . 31 site . . . 60 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 4 . . . 10 7 5 . 17 . . 14 6 1 4 . . 3 9 . . . 3 3 15 . . . 15 13 site . . . 6 4 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.277114 0.018125 0.016568 0.688193 0.624324 5 0.027807 0.713164 0.016568 0.242461 1.069052 6 0.410582 0.181812 0.016568 0.391038 0.219364 9 0.292224 0.018125 0.170182 0.519469 0.282094 15 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 4.734210 Conservedness in prob: 7.305541 Concensus sequence: TTCATT Complete log-likelihood ratio = 65 bits Missing position information = 54 bits Log-likelihood ratio statistic = 11 bits Degrees of freedom = 18 Information per parameter = 0.631 bits MOTIF G 1-1 535 tagccagata TTTTTG gGCCCGGAAT 540 0.166205 2-1 237 aatcattttc TTGTAT ttaTCGTCTT 242 1.634349 3-1 600 TGGAGAGcta TTGTTC aaaaaacaaa 605 1.385042 4-1 698 tcataacttt TTTTTT TGAACCTGAA 703 0.387812 5-1 255 gttaaatttt TTTTTT tttaaatttc 260 0.304709 6-1 172 ttttatgcta TTTTTT aaatttggag 177 0.415512 7-1 642 aaagagaagg TTTTTT taggctaaga 647 2.354571 8-1 591 atgcgattag TTTTTT agccttattt 596 2.354571 9-1 624 aactgcttct TTTTTT attaaaaaac 629 0.692521 10-1 358 ctttttgtcc TTTTTT ttttccgggg 363 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 535 540 537 -w 0.166205 >2 237 242 239 -w 1.634349 >3 600 605 602 -w 1.385042 >4 698 703 700 -w 0.387812 >5 255 260 257 -w 0.304709 >6 172 177 174 -w 0.415512 >7 642 647 644 -w 2.354571 >8 591 596 593 -w 2.354571 >9 624 629 626 -w 0.692521 >10 358 363 360 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 3 . . . 76 0.8 4 . . . 94 1.3 5 . . . 85 0.9 6 . . . 76 0.7 non- site . . . 31 site . . . 91 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 3 . . . 10 8 4 . . . 15 13 5 . . . 12 9 6 . . . 10 7 site . . . 14 12 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.291058 0.663010 0.757161 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.176384 0.018125 0.016568 0.788923 0.793916 6 0.027807 0.144038 0.031678 0.796478 0.831346 Conservedness in bits: 6.191487 Conservedness in prob: 8.525867 Concensus sequence: TTTTTT Complete log-likelihood ratio = 81 bits Missing position information = 52 bits Log-likelihood ratio statistic = 28 bits Degrees of freedom = 18 Information per parameter = 1.56 bits MOTIF H 1-1 35 gacgctatgt CCGTCGA tgacttgaag 41 0.166205 2-1 171 ttgcaaacaa CCGCCGG cagcttagta 177 1.634349 3-1 384 caggaaggca CCGGCGG tctttcgtcc 390 1.385042 4-1 628 tcttcattta CCGGCGC actctcgccc 634 0.387812 5-1 420 agttataaca CCGGCGA acaatcgggg 426 0.304709 6-1 630 tgaccgtgat CCGAAGG actggctata 636 0.415512 7-1 546 GGAGAGtctt CCGTCGG agggctgtcg 552 2.354571 8-1 381 cgacagccct CCGACGG aagactctcc 387 2.354571 9-1 93 tattagggag CCGCCGG tactaataac 99 0.692521 10-1 478 CAGAAAAatt CCGATGG acaagaagat 484 0.304709 sites: *** *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 35 41 38 -w 0.166205 >2 171 177 174 -w 1.634349 >3 384 390 387 -w 1.385042 >4 628 634 631 -w 0.387812 >5 420 426 423 -w 0.304709 >6 630 636 633 -w 0.415512 >7 546 552 549 -w 2.354571 >8 381 387 384 -w 2.354571 >9 93 99 96 -w 0.692521 >10 478 484 481 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 . 93 . . 1.8 3 . . 93 . 1.9 5 . 75 . . 1.0 6 . . 93 . 1.9 7 . . 65 . 0.9 non- site . 19 18 . site . 48 45 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 . 21 . . 18 3 . . 22 . 19 5 . 14 . . 10 6 . . 22 . 19 7 . . 12 . 9 site . 6 6 . 10 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.027807 0.927216 0.016568 0.028409 1.804236 3 0.027807 0.018125 0.925659 0.028409 1.913088 5 0.065581 0.861741 0.016568 0.056110 1.477775 6 0.027807 0.018125 0.925659 0.028409 1.913088 7 0.070617 0.053381 0.847593 0.028409 1.530392 Conservedness in bits: 10.442816 Conservedness in prob: 13.453189 Concensus sequence: CCGCGG Complete log-likelihood ratio = 116 bits Missing position information = 87 bits Log-likelihood ratio statistic = 28 bits Degrees of freedom = 18 Information per parameter = 1.6 bits MOTIF I 1-1 442 atcacttccg AGCGATTAATA catatctcca 452 0.166205 2-1 765 gtgcaaaaag AGAAAATAAAA gtaaaaaggt 775 1.634349 3-1 775 caagattaac ATAATAAAAAA aataattctt 785 1.385042 4-1 473 TAActtcttc ACTATAAGAAA atcacacgag 483 0.387812 5-1 790 ttactaaatt AAGATAGAAAA 800 0.304709 6-1 769 CATCAACatg ATAAAAAAAAA cagttgaata 779 0.415512 7-1 286 tatatctgtt AATAGATCAAA aatcatcgct 296 2.354571 8-1 790 cgtcaaggag AAAAAACTATA 800 2.354571 9-1 668 aacttaagga AACATACAAAA agatttgttc 678 0.692521 10-1 454 aagcgcgagg AGGAAAAGAAA tgaCAGAAAA 464 0.304709 sites: * * * *** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 442 452 447 -w 0.166205 >2 765 775 770 -w 1.634349 >3 775 785 780 -w 1.385042 >4 473 483 478 -w 0.387812 >5 790 800 795 -w 0.304709 >6 769 779 774 -w 0.415512 >7 286 296 291 -w 2.354571 >8 790 800 795 -w 2.354571 >9 668 678 673 -w 0.692521 >10 454 464 459 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 4 85 . . . 1.0 6 85 . . . 1.0 9 94 . . . 1.3 10 76 . . . 0.7 11 94 . . . 1.3 non- site 30 . . . site 93 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 4 12 . . . 10 6 12 . . . 10 9 15 . . . 13 10 10 . . . 7 11 15 . . . 13 site 15 . . . 13 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.921788 0.018125 0.031678 0.028409 1.226071 6 0.921788 0.018125 0.016568 0.043519 1.223227 9 0.936898 0.018125 0.016568 0.028409 1.294744 10 0.707736 0.018125 0.016568 0.257571 0.664700 11 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.998232 Conservedness in prob: 9.238104 Concensus sequence: AAAAAA Complete log-likelihood ratio = 84 bits Missing position information = 69 bits Log-likelihood ratio statistic = 14 bits Degrees of freedom = 18 Information per parameter = 0.83 bits MOTIF J 1-1 289 tgccgttggt AACGTTGAAA tggaagaaga 298 0.166205 2-1 264 TCGCTGTaaa AACTTTATCA cacttatctc 273 1.634349 3-1 631 cgcaggctaa AATGTGGAGA taggataagt 640 1.385042 4-1 456 aaccaaccta AAGGTATTAA cttcttcACT 465 0.387812 5-1 97 ctcaataggt AACATGAGAA tatttcagtt 106 0.304709 6-1 275 gagacatcaa AAATTGAAAA tctatggaaa 284 0.415512 7-1 222 gaagtaatac AAACTGAAAA tgttgaaagt 231 2.354571 8-1 512 atgaagagga AAAATTGGCA gtaacctggc 521 2.354571 9-1 168 AAGcggaaaa AAAGTTATCA ccccgccccc 177 0.692521 10-1 300 AGttcttggc AAGTTGCCAA ctgacgagat 309 0.304709 sites: ** ** ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 289 298 293 -w 0.166205 >2 264 273 268 -w 1.634349 >3 631 640 635 -w 1.385042 >4 456 465 460 -w 0.387812 >5 97 106 101 -w 0.304709 >6 275 284 279 -w 0.415512 >7 222 231 226 -w 2.354571 >8 512 521 516 -w 2.354571 >9 168 177 172 -w 0.692521 >10 300 309 304 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 94 . . . 1.3 5 . . . 94 1.3 6 . . 47 39 0.5 9 57 29 . . 0.5 10 94 . . . 1.3 non- site 30 . . . site 61 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 15 . . . 13 5 . . . 15 13 6 . . 6 1 5 9 5 2 . . 5 10 15 . . . 13 site 6 . . . 3 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.063062 0.018125 0.449708 0.469104 0.654557 9 0.385399 0.443710 0.142481 0.028409 0.491717 10 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.300195 Conservedness in prob: 8.887016 Concensus sequence: AATGCA Complete log-likelihood ratio = 80 bits Missing position information = 58 bits Log-likelihood ratio statistic = 21 bits Degrees of freedom = 18 Information per parameter = 1.18 bits seed 7 time: 7 seconds (0.12 minutes) MOTIF A 1-1 695 gtgaatttca CAGATCGA tatgctttgg 702 0.166205 2-1 327 tctacgctga CAGTAATA tcaaacagtg 334 1.634349 3-1 158 cacagcaata TAGGACTA gaaaatatca 165 1.385042 4-1 662 ctcaaaatgt CTGCTACA ttCATAATAA 669 0.387812 5-1 207 atatttcgcc CAGTTCTA catttttttt 214 0.304709 6-1 320 aacaagaata TAGCACGA gccgcggagt 327 0.415512 7-1 324 ttaattaccc CAGAAATA aggctaaaaa 331 2.354571 8-1 310 ttggaacttt CAGTAATA cgcttaactg 317 2.354571 9-1 310 aattattccc TAGAACAA gcgggaaaaa 317 0.692521 10-1 494 gacaagaaga TAGGAAAA aaaaaaagct 501 0.304709 sites: *** ** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 695 702 698 -w 0.166205 >2 327 334 330 -w 1.634349 >3 158 165 161 -w 1.385042 >4 662 669 665 -w 0.387812 >5 207 214 210 -w 0.304709 >6 320 327 323 -w 0.415512 >7 324 331 327 -w 2.354571 >8 310 317 313 -w 2.354571 >9 310 317 313 -w 0.692521 >10 494 501 497 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 56 . 39 0.8 2 85 . . . 1.0 3 . . 93 . 1.9 5 66 . . . 0.6 6 48 47 . . 0.8 8 94 . . . 1.3 non- site 30 . . . site 51 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 8 . 1 8 2 12 . . . 10 3 . . 22 . 19 5 7 . . . 6 6 3 6 . . 8 8 15 . . . 13 site 4 . . . 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.672872 0.016568 0.282753 0.986470 2 0.901642 0.018125 0.016568 0.063665 1.140065 3 0.027807 0.018125 0.925659 0.028409 1.913088 5 0.858832 0.018125 0.016568 0.106475 0.993762 6 0.667444 0.287579 0.016568 0.028409 0.747727 8 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 7.075856 Conservedness in prob: 9.889110 Concensus sequence: CAGAAA Complete log-likelihood ratio = 78 bits Missing position information = 65 bits Log-likelihood ratio statistic = 13 bits Degrees of freedom = 18 Information per parameter = 0.742 bits MOTIF B 1-1 128 gaagttttga TCAAGCAAGTTCCAAGACTA ttgggtcctc 147 0.166205 2-1 269 gtaaaaactt TATCACACTTATCTCAAATA cacttattaa 288 1.634349 3-1 724 attatgcacc TTATTCAATTATCATCAAGA atagtaatag 743 1.385042 4-1 13 tcctttacgt TTTGACTTGGTGCTCGAAGA tgctttcaga 32 0.387812 5-1 303 cgcttgaatg TCTTACATATTGCAATGGAT atgcttgggt 322 0.304709 6-1 626 CTGTTGACCG TGATCCGAAGGACTGGCTAT acagtgttca 645 0.415512 7-1 661 gctaagataa TGGGGCTCTTTACATTTCCA caacatataa 680 2.354571 8-1 638 gcgatgattt TTGATCTATTAACAGATATA tAAATGGaaa 657 2.354571 9-1 1 TAGCTCTATGTACATTGCCA aggttttcta 20 0.692521 10-1 641 caatttgccc TTTTCCATTTTCCATTAAAT ctctgttctc 660 0.304709 sites: * * * ** * 5 10 15 20 (10 sites in 10 sequences) Conservedness in sites: >1 128 147 137 -w 0.166205 >2 269 288 278 -w 1.634349 >3 724 743 733 -w 1.385042 >4 13 32 22 -w 0.387812 >5 303 322 312 -w 0.304709 >6 626 645 635 -w 0.415512 >7 661 680 670 -w 2.354571 >8 638 657 647 -w 2.354571 >9 1 20 10 -w 0.692521 >10 641 660 650 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 6 . 93 . . 1.8 10 . . 29 66 0.8 13 . 93 . . 1.8 14 66 . . . 0.6 20 66 . . . 0.6 non- site . 19 . 31 site . 33 . 38 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 6 . 21 . . 18 10 . . 2 7 8 13 . 21 . . 18 14 7 . . . 6 20 7 . . . 6 site . 2 . 1 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.927216 0.016568 0.028409 1.804236 10 0.027807 0.018125 0.152554 0.801514 0.891112 13 0.027807 0.927216 0.016568 0.028409 1.804236 14 0.715291 0.018125 0.016568 0.250016 0.676169 20 0.843722 0.018125 0.016568 0.121585 0.949458 Conservedness in bits: 7.394900 Conservedness in prob: 10.068090 Concensus sequence: TCTCAA Complete log-likelihood ratio = 86 bits Missing position information = 71 bits Log-likelihood ratio statistic = 14 bits Degrees of freedom = 18 Information per parameter = 0.823 bits MOTIF C 1-1 417 Tgggtccagc TTTCAGATTGTACT aatcacttcc 430 0.166205 2-1 12 tgctaaatca TTTGGCTTTTTGAT tgattgtaca 25 1.634349 3-1 304 cttaagtagg TTGCAATTTCTTTT tctattagta 317 1.385042 4-1 44 gctttcagag ATGGTGCTTATCCT catgtctttt 57 0.387812 5-1 255 gttaaatttt TTTTTTTTTAAATT tcaCTTTCTA 268 0.304709 6-1 458 ggggtaattt TTCCCCTTTATTTT gttcatacat 471 0.415512 7-1 29 gcttataaat TTCTTAATTATGCT cgggcacttt 42 2.354571 8-1 153 ttttcaaaaa TTCTTACTTTTTTT ttggatggac 166 2.354571 9-1 579 CAAatgacat TTTTCCTTTCTTCT caaactttgt 592 0.692521 10-1 352 ttgaaacttt TTGTCCTTTTTTTT ttccggggac 365 0.304709 sites: ** ** * * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 417 430 423 -w 0.166205 >2 12 25 18 -w 1.634349 >3 304 317 310 -w 1.385042 >4 44 57 50 -w 0.387812 >5 255 268 261 -w 0.304709 >6 458 471 464 -w 0.415512 >7 29 42 35 -w 2.354571 >8 153 166 159 -w 2.354571 >9 579 592 585 -w 0.692521 >10 352 365 358 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 0.9 2 . . . 94 1.3 8 . . . 94 1.3 9 . . . 94 1.3 11 . . . 85 0.9 14 . . . 94 1.3 non- site . . . 31 site . . . 96 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 9 2 . . . 15 13 8 . . . 15 13 9 . . . 15 13 11 . . . 12 9 14 . . . 15 13 site . . . 16 15 Weighted motif model: POS A C G T Prob 1 0.063062 0.018125 0.016568 0.902244 1.116449 2 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.027807 0.018125 0.016568 0.937500 1.269688 9 0.027807 0.018125 0.016568 0.937500 1.269688 11 0.055508 0.018125 0.016568 0.909799 1.145941 14 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.341141 Conservedness in prob: 9.411204 Concensus sequence: TTTTTT Complete log-likelihood ratio = 90 bits Missing position information = 68 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.24 bits MOTIF D 1-1 35 gacgctatgt CCGTCGATGACTTGAAG aagttgaaCA 51 0.166205 2-1 164 ctcggtcttg CAAACAACCGCCGGCAG cttagtatat 180 1.634349 3-1 392 caccggcggt CTTTCGTCCGTGCGGAG atatCTGCGC 408 1.385042 4-1 490 gaaaatcaca CGAGCGCCCGGACGATG tctctgttta 506 0.387812 5-1 577 gcctatcagg CATTCACCCGTGTGACG aatcgcacac 593 0.304709 6-1 609 AAAAagcgct CGGACAACTGTTGACCG TGATCCGAAG 625 0.415512 7-1 543 ggaggagagt CTTCCGTCGGAGGGCTG tcgcccgctc 559 2.354571 8-1 374 gagcgggcga CAGCCCTCCGACGGAAG actCTCCTCC 390 2.354571 9-1 209 tccactaaaa CGATCAGCAAATGGCAG aataacgcgg 225 0.692521 10-1 734 cactctaaag CATACCCCATAGAGAAG atctttcggt 750 0.304709 sites: * * * * * * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 35 51 43 -w 0.166205 >2 164 180 172 -w 1.634349 >3 392 408 400 -w 1.385042 >4 490 506 498 -w 0.387812 >5 577 593 585 -w 0.304709 >6 609 625 617 -w 0.415512 >7 543 559 551 -w 2.354571 >8 374 390 382 -w 2.354571 >9 209 225 217 -w 0.692521 >10 734 750 742 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 5 . 93 . . 1.8 8 . 84 . . 1.4 10 . . 65 . 0.9 14 . . 83 . 1.5 17 . . 93 . 1.9 non- site . 19 18 . site . 48 43 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 5 . 21 . . 18 8 . 17 . . 14 10 . . 12 . 9 14 . . 18 . 15 17 . . 22 . 19 site . 6 5 . 9 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 5 0.027807 0.927216 0.016568 0.028409 1.804236 8 0.027807 0.912106 0.016568 0.043519 1.723618 10 0.105873 0.018125 0.819892 0.056110 1.415003 14 0.065581 0.018125 0.887885 0.028409 1.721658 17 0.027807 0.018125 0.925659 0.028409 1.913088 Conservedness in bits: 10.381839 Conservedness in prob: 13.427091 Concensus sequence: CCCGGG Complete log-likelihood ratio = 115 bits Missing position information = 85 bits Log-likelihood ratio statistic = 30 bits Degrees of freedom = 18 Information per parameter = 1.68 bits MOTIF E 1-1 369 tgaagaagaa CTGGCAAAA tgttggttcc 377 0.166205 2-1 626 tgattgaccg CCTGCAACA cataggcagt 634 1.634349 3-1 12 attaattttg CTTCCAAGA cgaCAGTAAT 20 1.385042 4-1 373 gacctgaaga CATGCAACA aagtgcaagc 381 0.387812 5-1 272 TTAAATTtca CTTTCTAAA gtcccagaaa 280 0.304709 6-1 594 taagggaaag GGTCCAAAA agcgctCGGA 602 0.415512 7-1 760 tctttgcgtc CATCCAAAA aaaaagtaag 768 2.354571 8-1 693 ttaactaata CTTTCAACA ttttcagttt 701 2.354571 9-1 670 cttaaggaaa CATACAAAA agatttgttc 678 0.692521 10-1 310 aagttgccaa CTGACGAGA tgcagtaaaa 318 0.304709 sites: * * *** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 369 377 373 -w 0.166205 >2 626 634 630 -w 1.634349 >3 12 20 16 -w 1.385042 >4 373 381 377 -w 0.387812 >5 272 280 276 -w 0.304709 >6 594 602 598 -w 0.415512 >7 760 768 764 -w 2.354571 >8 693 701 697 -w 2.354571 >9 670 678 674 -w 0.692521 >10 310 318 314 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 84 . . 1.5 3 . . . 76 0.8 5 . 93 . . 1.8 6 76 . . . 0.7 7 94 . . . 1.3 9 94 . . . 1.3 non- site 30 19 . . site 46 31 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 17 . . 15 3 . . . 10 8 5 . 21 . . 18 6 10 . . . 7 7 15 . . . 13 9 15 . . . 13 site 3 2 . . 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.889442 0.054342 0.028409 1.629552 3 0.027807 0.018125 0.059379 0.894690 1.102752 5 0.027807 0.927216 0.016568 0.028409 1.804236 6 0.881496 0.018125 0.044269 0.056110 1.053961 7 0.936898 0.018125 0.016568 0.028409 1.294744 9 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 8.179991 Conservedness in prob: 10.649279 Concensus sequence: CTCAAA Complete log-likelihood ratio = 91 bits Missing position information = 73 bits Log-likelihood ratio statistic = 18 bits Degrees of freedom = 18 Information per parameter = 1.02 bits MOTIF F 1-1 783 ttccatgcgc AAATAG attacttgca 788 0.166205 2-1 761 aggagtgcaa AAAGAG aaaataaaag 766 1.634349 3-1 548 tactcctgct AGAAAG ttaactgtgc 553 1.385042 4-1 324 ttccatagag AGAAGG agcaagcaac 329 0.387812 5-1 123 agttcgtaag AGAGAA gagatgaagt 128 0.304709 6-1 34 cttgaaaaac GGTGAA acttacgggt 39 0.415512 7-1 600 tcaatatagc AATGAG cagttaagcg 605 2.354571 8-1 659 ACAGATATAt AAATGG aaaagctgca 664 2.354571 9-1 778 attcgaacgc ATAGAG tacacacact 783 0.692521 10-1 787 gcataataag AATAGG agggaata 792 0.304709 sites: ****** 5 (10 sites in 10 sequences) Conservedness in sites: >1 783 788 785 -w 0.166205 >2 761 766 763 -w 1.634349 >3 548 553 550 -w 1.385042 >4 324 329 326 -w 0.387812 >5 123 128 125 -w 0.304709 >6 34 39 36 -w 0.415512 >7 600 605 602 -w 2.354571 >8 659 664 661 -w 2.354571 >9 778 783 780 -w 0.692521 >10 787 792 789 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 2 48 . 38 . 0.5 3 66 . . . 0.6 4 . . 47 . 0.5 5 66 . 29 . 0.8 6 . . 74 . 1.2 non- site 30 . 18 . site 55 . 35 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 2 3 . 4 . 5 3 7 . . . 6 4 . . 6 . 5 5 7 . 2 . 8 6 . . 15 . 12 site 5 . 3 . 6 Weighted motif model: POS A C G T Prob 1 0.899124 0.018125 0.054342 0.028409 1.142806 2 0.647298 0.018125 0.243211 0.091366 0.576495 3 0.657371 0.018125 0.016568 0.307936 0.599029 4 0.216676 0.018125 0.507628 0.257571 0.507890 5 0.659889 0.018125 0.293576 0.028409 0.772949 6 0.093282 0.018125 0.860184 0.028409 1.604919 Conservedness in bits: 5.204088 Conservedness in prob: 8.566695 Concensus sequence: AAAGAG Complete log-likelihood ratio = 57 bits Missing position information = 50 bits Log-likelihood ratio statistic = 6 bits Degrees of freedom = 18 Information per parameter = 0.356 bits MOTIF G 1-1 514 taaaagtatt ATGCATAGTTTTAG ccaGATATTT 527 0.166205 2-1 660 ttttactgaa ACGTATATAATCAT cataagcgac 673 1.634349 3-1 658 agttttgtag ACATATATAAACAA tcagtaattg 671 1.385042 4-1 205 gtgtcttttt ATGTATCGTGGAAT ttatcctgct 218 0.387812 5-1 744 agcttaatag GTGCATCTTAGCAA gctaaaattt 757 0.304709 6-1 284 aaaattgaaa ATCTATGGAAAGAT atggacggta 297 0.415512 7-1 238 aaaatgttga AAGTATTAGTTAAA gtggttatgc 251 2.354571 8-1 566 tcaaattaac AACCATAGGATGAT aatgcgatta 579 2.354571 9-1 558 aagaaaaaaa ATTTATATAACCAA atgacatTTT 571 0.692521 10-1 601 gacaaattgt AAAGATATAATAAA ctatttgatt 614 0.304709 sites: * ** * ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 514 527 520 -w 0.166205 >2 660 673 666 -w 1.634349 >3 658 671 664 -w 1.385042 >4 205 218 211 -w 0.387812 >5 744 757 750 -w 0.304709 >6 284 297 290 -w 0.415512 >7 238 251 244 -w 2.354571 >8 566 579 572 -w 2.354571 >9 558 571 564 -w 0.692521 >10 601 614 607 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 5 94 . . . 1.3 6 . . . 94 1.3 10 66 . . . 0.5 13 94 . . . 1.3 14 48 . . 39 0.3 non- site 30 . . . site 68 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 5 15 . . . 13 6 . . . 15 13 10 7 . . . 5 13 15 . . . 13 14 3 . . 1 3 site 8 . . . 6 Weighted motif model: POS A C G T Prob 1 0.909197 0.018125 0.044269 0.028409 1.177581 5 0.936898 0.018125 0.016568 0.028409 1.294744 6 0.027807 0.018125 0.016568 0.937500 1.269688 10 0.672481 0.018125 0.051824 0.257571 0.535752 13 0.936898 0.018125 0.016568 0.028409 1.294744 14 0.486130 0.018125 0.031678 0.464068 0.447001 Conservedness in bits: 6.019510 Conservedness in prob: 8.191461 Concensus sequence: AATAAA Complete log-likelihood ratio = 71 bits Missing position information = 58 bits Log-likelihood ratio statistic = 13 bits Degrees of freedom = 18 Information per parameter = 0.768 bits MOTIF H 1-1 531 GTTTTAGcca GATATTT ttgggcccgg 537 0.166205 2-1 545 GCTCCTTcac TATTTTA acatgtggaa 551 1.634349 3-1 693 attgaaaatt TGGTGTT gtgaattgct 699 1.385042 4-1 597 ttaattctaa TATTAAT aatatcctat 603 0.387812 5-1 439 aatcggggca GACTATT ccggggAAGA 445 0.304709 6-1 170 aattttatgc TATTTTT taaatttgga 176 0.415512 7-1 461 gtagaatctt TATTGTT cggagcagtg 467 2.354571 8-1 134 agctgtcatt TATATTG aattttcaaa 140 2.354571 9-1 646 aaacagcatg GAGTTTT ttaataactt 652 0.692521 10-1 113 attgtatgat AATGTTT tcaatgtaag 119 0.304709 sites: **** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 531 537 534 -w 0.166205 >2 545 551 548 -w 1.634349 >3 693 699 696 -w 1.385042 >4 597 603 600 -w 0.387812 >5 439 445 442 -w 0.304709 >6 170 176 173 -w 0.415512 >7 461 467 464 -w 2.354571 >8 134 140 137 -w 2.354571 >9 646 652 649 -w 0.692521 >10 113 119 116 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 29 57 0.5 2 85 . . . 1.0 3 . . . 66 0.6 4 . . . 66 0.5 6 . . . 85 0.9 7 . . . 76 0.7 non- site . . . 31 site . . . 61 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 2 5 5 2 12 . . . 10 3 . . . 7 6 4 . . . 7 5 6 . . . 12 9 7 . . . 10 7 site . . . 6 4 Weighted motif model: POS A C G T Prob 1 0.055508 0.018125 0.122335 0.804032 0.826491 2 0.810985 0.018125 0.142481 0.028409 0.929256 3 0.027807 0.045826 0.205437 0.720930 0.711535 4 0.256968 0.018125 0.044269 0.680638 0.546708 6 0.063062 0.018125 0.016568 0.902244 1.116449 7 0.176384 0.018125 0.230620 0.574871 0.381059 Conservedness in bits: 4.511497 Conservedness in prob: 7.508208 Concensus sequence: TATTTT Complete log-likelihood ratio = 47 bits Missing position information = 48 bits Log-likelihood ratio statistic = -1 bits Degrees of freedom = 18 Information per parameter = -0.0776 bits MOTIF I 1-1 60 AGaagttgaa CAAGAACAAGA agttaatcaa 70 0.166205 2-1 373 ggtttctttg CATAAACACCA tcagcctcaa 383 1.634349 3-1 24 TCCAAGAcga CAGTAATATGT ctcctacaat 34 1.385042 4-1 672 CTGCTACAtt CATAATAACCA aaagctcata 682 0.387812 5-1 452 TATTccgggg AAGAACAAGGA agggcggtct 462 0.304709 6-1 771 tcaacatgat AAAAAAAAACA gttgaatatt 781 0.415512 7-1 501 atctgcgttt CAGGAACGCGA ccggtgaaga 511 2.354571 8-1 739 aatgtcataa AAGTATCAACA aaaaattgtt 749 2.354571 9-1 750 ccacaagcag CAATACAAAGA gaattttatt 760 0.692521 10-1 548 agtcgtatga CATCAGAATGA aaaattttca 558 0.304709 sites: ** * * ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 60 70 65 -w 0.166205 >2 373 383 378 -w 1.634349 >3 24 34 29 -w 1.385042 >4 672 682 677 -w 0.387812 >5 452 462 457 -w 0.304709 >6 771 781 776 -w 0.415512 >7 501 511 506 -w 2.354571 >8 739 749 744 -w 2.354571 >9 750 760 755 -w 0.692521 >10 548 558 553 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 65 . . 1.0 2 94 . . . 1.3 5 94 . . . 1.3 8 85 . . . 1.0 10 . 38 56 . 1.1 11 85 . . . 1.0 non- site 30 . . . site 68 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 11 . . 10 2 15 . . . 13 5 15 . . . 13 8 12 . . . 10 10 . 4 9 . 11 11 12 . . . 10 site 8 . . . 6 Weighted motif model: POS A C G T Prob 1 0.307333 0.647689 0.016568 0.028409 0.947467 2 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.936898 0.018125 0.016568 0.028409 1.294744 8 0.722846 0.018125 0.230620 0.028409 0.814205 10 0.027807 0.453784 0.490001 0.028409 1.043112 11 0.810985 0.018125 0.016568 0.154322 0.863734 Conservedness in bits: 6.258007 Conservedness in prob: 9.004059 Concensus sequence: CAAAGA Complete log-likelihood ratio = 85 bits Missing position information = 59 bits Log-likelihood ratio statistic = 25 bits Degrees of freedom = 18 Information per parameter = 1.44 bits MOTIF J 1-1 399 tggttgttaa GTCCTCCAT gggtccagcT 407 0.166205 2-1 533 tgtgccgaac ATGCTCCTT cacTATTTTA 541 1.634349 3-1 413 GCGGAGatat CTGCGCCGT tcaggggtcc 421 1.385042 4-1 112 aaacggccgc CTCTGCCAT ggcaaagaat 120 0.387812 5-1 476 gcggtctttt CTCCCTCAT tgtcatagca 484 0.304709 6-1 112 aatatgcact CTATATCTT ttagttctta 120 0.415512 7-1 264 ggttatgcag CTTTTCCAT ttatatatct 272 2.354571 8-1 394 ACGGAAGact CTCCTCCGT gcgtcctcgt 402 2.354571 9-1 616 gcgcctgtaa CTGCTTCTT tttttattaa 624 0.692521 10-1 388 tacgagaacc CTTTGTCCT actgattaat 396 0.304709 sites: ** * ** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 399 407 403 -w 0.166205 >2 533 541 537 -w 1.634349 >3 413 421 417 -w 1.385042 >4 112 120 116 -w 0.387812 >5 476 484 480 -w 0.304709 >6 112 120 116 -w 0.415512 >7 264 272 268 -w 2.354571 >8 394 402 398 -w 2.354571 >9 616 624 620 -w 0.692521 >10 388 396 392 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 75 . . 1.1 2 . . . 94 1.3 4 . 56 . 39 0.8 6 . 56 . 39 0.8 7 . 93 . . 1.8 9 . . . 94 1.3 non- site . 19 . 31 site . 50 . 46 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 14 . . 11 2 . . . 15 13 4 . 8 . 1 8 6 . 8 . 1 8 7 . 21 . . 18 9 . . . 15 13 site . 7 . 3 8 Weighted motif model: POS A C G T Prob 1 0.176384 0.763529 0.031678 0.028409 1.160774 2 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.612434 0.016568 0.343191 0.884445 6 0.027807 0.771084 0.016568 0.184541 1.210948 7 0.027807 0.927216 0.016568 0.028409 1.804236 9 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.599779 Conservedness in prob: 10.895017 Concensus sequence: CTCCCT Complete log-likelihood ratio = 88 bits Missing position information = 64 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.38 bits seed 8 time: 7 seconds (0.12 minutes) MOTIF A 1-1 545 tttttgggcc CGGAATATATCTTTTCG ggaagctcgg 561 0.166205 2-1 513 accccacgtt CGGTCCACTGTGTGCCG aacatgctcc 529 1.634349 3-1 473 agtatcgggg CGGATCACTCCGAACCG agattagtta 489 1.385042 4-1 629 CTTCATTtac CGGCGCACTCTCGCCCG aacgacctca 645 0.387812 5-1 432 ggcgaacaat CGGGGCAGACTATTCCG gggaagaaca 448 0.304709 6-1 609 aaaaagcgct CGGACAACTGTTGACCG tgatccgaag 625 0.415512 7-1 532 cgaggacgca CGGAGGAGAGTCTTCCG tcggagggct 548 2.354571 8-1 367 agccgccgag CGGGCGACAGCCCTCCG acggaagact 383 2.354571 9-1 332 gaaaaaggtc CGGGGAAATGGAGTCCG tgcgagtttt 348 0.692521 10-1 757 gaagatcttt CGGTTCGAAGACATTCC tacgCATAAT 773 0.304709 sites: *** * ** 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 545 561 553 -w 0.166205 >2 513 529 521 -w 1.634349 >3 473 489 481 -w 1.385042 >4 629 645 637 -w 0.387812 >5 432 448 440 -w 0.304709 >6 609 625 617 -w 0.415512 >7 532 548 540 -w 2.354571 >8 367 383 375 -w 2.354571 >9 332 348 340 -w 0.692521 >10 757 773 765 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 . . 93 . 1.9 3 . . 93 . 1.9 7 85 . . . 1.0 16 . 93 . . 1.8 17 . . 83 . 1.5 non- site . 19 18 . site . 35 50 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 . . 22 . 19 3 . . 22 . 19 7 12 . . . 10 16 . 21 . . 18 17 . . 18 . 15 site . 3 7 . 9 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.027807 0.018125 0.925659 0.028409 1.913088 3 0.027807 0.018125 0.925659 0.028409 1.913088 7 0.909197 0.018125 0.044269 0.028409 1.177581 16 0.027807 0.927216 0.016568 0.028409 1.804236 17 0.027807 0.045826 0.897958 0.028409 1.774276 Conservedness in bits: 10.386505 Conservedness in prob: 12.996346 Concensus sequence: CGGACG Complete log-likelihood ratio = 127 bits Missing position information = 84 bits Log-likelihood ratio statistic = 42 bits Degrees of freedom = 18 Information per parameter = 2.38 bits MOTIF B 1-1 106 gtacaacgct TTCATTGCTTC cgaagttttg 116 0.166205 2-1 453 GTTGATAATT AGCGTTGCCTC atcaatgcga 463 1.634349 3-1 5 catt AATTTTGCTTC caagacgaca 15 1.385042 4-1 48 tcagagatgg TGCTTATCCTC atgtcttttg 58 0.387812 5-1 233 TTTTtttgga AGTATGACCTC tgttaaattt 243 0.304709 6-1 490 attcttaaat TGCTTTGCCTC tccttttgga 500 0.415512 7-1 101 gaactcaggt ACAATCACTTC ttctgaatga 111 2.354571 8-1 711 ATTttcagtt TGTATTACTTC ttattcaaaT 721 2.354571 9-1 581 aatgacattt TTCCTTTCTTC tcaaactttg 591 0.692521 10-1 22 TCTactcata ACTTTAGCATC acaaaatacg 32 0.304709 sites: * * **** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 106 116 111 -w 0.166205 >2 453 463 458 -w 1.634349 >3 5 15 10 -w 1.385042 >4 48 58 53 -w 0.387812 >5 233 243 238 -w 0.304709 >6 490 500 495 -w 0.415512 >7 101 111 106 -w 2.354571 >8 711 721 716 -w 2.354571 >9 581 591 586 -w 0.692521 >10 22 32 27 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 48 . . 48 0.5 5 . . . 94 1.3 8 . 93 . . 1.8 9 . 38 . 48 0.4 10 . . . 94 1.3 11 . 93 . . 1.8 non- site . 19 . 31 site . 40 . 50 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 3 . . 3 5 5 . . . 15 13 8 . 21 . . 18 9 . 4 . 3 4 10 . . . 15 13 11 . 21 . . 18 site . 4 . 3 6 Weighted motif model: POS A C G T Prob 1 0.571750 0.018125 0.016568 0.393556 0.526895 5 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.027807 0.927216 0.016568 0.028409 1.804236 9 0.055508 0.267432 0.016568 0.660492 0.632444 10 0.027807 0.018125 0.016568 0.937500 1.269688 11 0.027807 0.927216 0.016568 0.028409 1.804236 Conservedness in bits: 7.307188 Conservedness in prob: 9.586894 Concensus sequence: ATCTTC Complete log-likelihood ratio = 91 bits Missing position information = 66 bits Log-likelihood ratio statistic = 24 bits Degrees of freedom = 18 Information per parameter = 1.37 bits MOTIF C 1-1 356 TTTGTTtctt TGTTGAAGAAGAACTGGCAAAA tgttggttcc 377 0.166205 2-1 741 tacttcctat TAGCGGAATCAGGAGTGCAAAA aGAGAAAATA 762 1.634349 3-1 149 GATTcagatc ACAGCAATATAGGACTAGAAAA tatcaggtag 170 1.385042 4-1 363 actgccactg GACCTGAAGACATGCAACAAAG tgcaagcata 384 0.387812 5-1 779 gacagctctc ATTACTAAATTAAGATAGAAAA 800 0.304709 6-1 255 aagttctctg TACCACCATGGAGACATCAAAA attgaaaatc 276 0.415512 7-1 276 TTTCCATTTa TATATCTGTTAATAGATCAAAA atcatcgctT 297 2.354571 8-1 731 Cttattcaaa TGTCATAAAAGTATCAACAAAA aattgttaat 752 2.354571 9-1 658 gttttttaat AACTTAAGGAAACATACAAAAA gatttgttcA 679 0.692521 10-1 485 attccgatgg ACAAGAAGATAGGAAAAAAAAA aagctttcac 506 0.304709 sites: * * **** 5 10 15 20 (10 sites in 10 sequences) Conservedness in sites: >1 356 377 366 -w 0.166205 >2 741 762 751 -w 1.634349 >3 149 170 159 -w 1.385042 >4 363 384 373 -w 0.387812 >5 779 800 789 -w 0.304709 >6 255 276 265 -w 0.415512 >7 276 297 286 -w 2.354571 >8 731 752 741 -w 2.354571 >9 658 679 668 -w 0.692521 >10 485 506 495 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 39 . . 48 0.3 7 76 . . . 0.7 19 94 . . . 1.3 20 94 . . . 1.3 21 94 . . . 1.3 22 85 . . . 1.0 non- site 30 . . . site 85 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 1 . . 3 3 7 10 . . . 7 19 15 . . . 13 20 15 . . . 13 21 15 . . . 13 22 12 . . . 10 site 13 . . . 9 Weighted motif model: POS A C G T Prob 1 0.272078 0.018125 0.051824 0.657973 0.504095 7 0.685072 0.055899 0.016568 0.242461 0.548319 19 0.936898 0.018125 0.016568 0.028409 1.294744 20 0.936898 0.018125 0.016568 0.028409 1.294744 21 0.936898 0.018125 0.016568 0.028409 1.294744 22 0.901642 0.018125 0.051824 0.028409 1.151211 Conservedness in bits: 6.087858 Conservedness in prob: 8.641947 Concensus sequence: TAAAAA Complete log-likelihood ratio = 74 bits Missing position information = 58 bits Log-likelihood ratio statistic = 15 bits Degrees of freedom = 18 Information per parameter = 0.869 bits MOTIF D 1-1 668 acttgcctta CTTTAAAAG catgttgagt 676 0.166205 2-1 327 tctacgctga CAGTAATAT caaacagtga 335 1.634349 3-1 41 atgtctccta CAATACCAG tttcgctgca 49 1.385042 4-1 137 gaatgctttc CATGACGAT catcgtagtg 145 0.387812 5-1 707 agaatcaaga CATTCTAAT gacttgattc 715 0.304709 6-1 759 ttatgcagag CATCAACAT gATAAAAAAA 767 0.415512 7-1 429 ttttcctctt CATAACCAT aaaagctagt 437 2.354571 8-1 18 tcagcaacaa CACAGTCAT atccattctc 26 2.354571 9-1 112 ctaataacat CAAGGCCAT ctcacgccga 120 0.692521 10-1 778 CATTCCtacg CATAATAAG aataggaggg 786 0.304709 sites: ** ** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 668 676 672 -w 0.166205 >2 327 335 331 -w 1.634349 >3 41 49 45 -w 1.385042 >4 137 145 141 -w 0.387812 >5 707 715 711 -w 0.304709 >6 759 767 763 -w 0.415512 >7 429 437 433 -w 2.354571 >8 18 26 22 -w 2.354571 >9 112 120 116 -w 0.692521 >10 778 786 782 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 85 . . . 1.0 5 66 . . . 0.6 6 . 38 . . 0.3 8 94 . . . 1.3 9 . . 29 66 0.8 non- site 30 19 . . site 48 25 . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 12 . . . 10 5 7 . . . 6 6 . 4 . . 3 8 15 . . . 13 9 . . 2 7 8 site 3 1 . . 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.921788 0.018125 0.016568 0.043519 1.223227 5 0.632189 0.045826 0.293576 0.028409 0.668602 6 0.229267 0.456302 0.016568 0.297863 0.371768 8 0.936898 0.018125 0.016568 0.028409 1.294744 9 0.027807 0.018125 0.185291 0.768777 0.843943 Conservedness in bits: 6.206521 Conservedness in prob: 8.964488 Concensus sequence: CAACAT Complete log-likelihood ratio = 71 bits Missing position information = 63 bits Log-likelihood ratio statistic = 8 bits Degrees of freedom = 18 Information per parameter = 0.452 bits MOTIF E 1-1 702 tcacagatcg ATATGCTT tggtgttcaa 709 0.166205 2-1 11 atgctaaatc ATTTGGCT ttttgattga 18 1.634349 3-1 537 aaatggcatt ATACTCCT gctagaaagt 544 1.385042 4-1 258 gcaaggttgg CCTCTACT tactccaTCG 265 0.387812 5-1 563 cggcttaata ATATGCCT atcaggcatt 570 0.304709 6-1 565 ATTTTCTgtc ATTTTCCT taacccaaaa 572 0.415512 7-1 202 cttttatgac ATTTGAAT aagaagtaat 209 2.354571 8-1 441 tgaaacgcag ATGTGCCT cgcgccgcac 448 2.354571 9-1 689 Agatttgttc ATTTCACT ccaagtattt 696 0.692521 10-1 617 ataataaact ATTTGATT cagcgccaat 624 0.304709 sites: ** ** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 702 709 705 -w 0.166205 >2 11 18 14 -w 1.634349 >3 537 544 540 -w 1.385042 >4 258 265 261 -w 0.387812 >5 563 570 566 -w 0.304709 >6 565 572 568 -w 0.415512 >7 202 209 205 -w 2.354571 >8 441 448 444 -w 2.354571 >9 689 696 692 -w 0.692521 >10 617 624 620 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 2 . . . 85 1.0 4 . . . 76 0.8 5 . . 56 . 0.7 7 . 65 . . 0.8 8 . . . 94 1.3 non- site . . . 31 site . . . 53 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 2 . . . 12 10 4 . . . 10 8 5 . . 9 . 7 7 . 11 . . 8 8 . . . 15 13 site . . . 4 2 Weighted motif model: POS A C G T Prob 1 0.901642 0.053381 0.016568 0.028409 1.149135 2 0.027807 0.053381 0.016568 0.902244 1.125135 4 0.027807 0.179293 0.016568 0.776332 0.838208 5 0.027807 0.081081 0.663760 0.227351 0.931961 7 0.241859 0.670354 0.016568 0.071219 0.881542 8 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 6.195669 Conservedness in prob: 9.601235 Concensus sequence: ATTGCT Complete log-likelihood ratio = 68 bits Missing position information = 62 bits Log-likelihood ratio statistic = 6 bits Degrees of freedom = 18 Information per parameter = 0.339 bits MOTIF F 1-1 343 gtctgttaac TTCTTTGTT tcttTGTTGA 351 0.166205 2-1 362 ttaaacacag TGGTTTCTT tgcataaaca 370 1.634349 3-1 112 taatccaagg AGGTTTACG gaccagggga 120 1.385042 4-1 526 aaatggcgca AGTTTTCCG ctttgtaata 534 0.387812 5-1 218 agttctacat TTTTTTTTT tttggaAGTA 226 0.304709 6-1 553 ctcattagat ATATTTTCT gtcATTTTCC 561 0.415512 7-1 642 aaagagaagg TTTTTTTAG gctaagataa 650 2.354571 8-1 632 agcgaagcga TGATTTTTG atctattaac 640 2.354571 9-1 501 caagtgcctt TTTTTTTTT ttttcatccc 509 0.692521 10-1 6 tctca TTTTTTTCT actcataACT 14 0.304709 sites: ** *** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 343 351 347 -w 0.166205 >2 362 370 366 -w 1.634349 >3 112 120 116 -w 1.385042 >4 526 534 530 -w 0.387812 >5 218 226 222 -w 0.304709 >6 553 561 557 -w 0.415512 >7 642 650 646 -w 2.354571 >8 632 640 636 -w 2.354571 >9 501 509 505 -w 0.692521 >10 6 14 10 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 66 0.6 2 . . 38 57 0.7 4 . . . 94 1.3 5 . . . 94 1.3 6 . . . 94 1.3 9 . . 38 57 0.7 non- site . . . 31 site . . . 81 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 7 6 2 . . 4 5 7 4 . . . 15 13 5 . . . 15 13 6 . . . 15 13 9 . . 4 5 7 site . . . 11 9 Weighted motif model: POS A C G T Prob 1 0.226749 0.018125 0.016568 0.738558 0.698503 2 0.027807 0.018125 0.540366 0.413702 0.855846 4 0.027807 0.018125 0.016568 0.937500 1.269688 5 0.027807 0.018125 0.016568 0.937500 1.269688 6 0.027807 0.018125 0.016568 0.937500 1.269688 9 0.027807 0.018125 0.605840 0.348228 0.945419 Conservedness in bits: 6.308832 Conservedness in prob: 9.296778 Concensus sequence: TGTTTG Complete log-likelihood ratio = 76 bits Missing position information = 56 bits Log-likelihood ratio statistic = 19 bits Degrees of freedom = 18 Information per parameter = 1.1 bits MOTIF G 1-1 591 caccgatccg ATTCTTACTCC atatcatgcc 601 0.166205 2-1 679 atcatcataa GCGACAAGTGA ggcaacacct 689 1.634349 3-1 569 tgtgcacata TTCTTAAATTA tacaacattc 579 1.385042 4-1 273 ACTtactcca TCGACAATTCA agatacagaa 283 0.387812 5-1 80 caatgtcccc GCAACTACTCA ataggtaaca 90 0.304709 6-1 168 cgaattttat GCTATTTTTTA aatttggagt 178 0.415512 7-1 307 Aatcatcgct TCGCTGATTAA ttaccccaga 317 2.354571 8-1 125 ttgtaactga GCTGTCATTTA tattgaattt 135 2.354571 9-1 24 attgccaagg TTTTCTACTGA tcaatatttg 34 0.692521 10-1 669 atctctgttc TCTCTTACTTA tatgatgatt 679 0.304709 sites: ** * * * * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 591 601 596 -w 0.166205 >2 679 689 684 -w 1.634349 >3 569 579 574 -w 1.385042 >4 273 283 278 -w 0.387812 >5 80 90 85 -w 0.304709 >6 168 178 173 -w 0.415512 >7 307 317 312 -w 2.354571 >8 125 135 130 -w 2.354571 >9 24 34 29 -w 0.692521 >10 669 679 674 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 38 48 0.5 2 . 65 . . 1.0 5 . 38 . 57 0.7 7 85 . . . 1.0 9 . . . 94 1.3 11 85 . . . 1.0 non- site . . . 31 site . . . 41 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 4 3 5 2 . 11 . . 10 5 . 4 . 5 7 7 12 . . . 10 9 . . . 15 13 11 12 . . . 10 site . . . 2 1 Weighted motif model: POS A C G T Prob 1 0.042916 0.018125 0.444672 0.494287 0.714882 2 0.027807 0.723237 0.016568 0.232388 1.091670 5 0.027807 0.292615 0.016568 0.663010 0.727937 7 0.899124 0.018125 0.016568 0.066183 1.130433 9 0.027807 0.018125 0.016568 0.937500 1.269688 11 0.921788 0.033235 0.016568 0.028409 1.225521 Conservedness in bits: 6.160131 Conservedness in prob: 8.963014 Concensus sequence: GCTATA Complete log-likelihood ratio = 66 bits Missing position information = 51 bits Log-likelihood ratio statistic = 15 bits Degrees of freedom = 18 Information per parameter = 0.834 bits MOTIF H 1-1 503 actctaagta GTAAAAGTAT tatgcatagt 512 0.166205 2-1 764 AGTGCAAAAa GAGAAAATAA aagtaaaaag 773 1.634349 3-1 773 cacaagatta ACATAATAAA aaaaataatt 782 1.385042 4-1 481 tcactataag AAAATCACAC gagcgcccgg 490 0.387812 5-1 124 gttcgtaaga GAGAAGAGAT gaagttattt 133 0.304709 6-1 769 CATCAACATg ATAAAAAAAA acagttgaat 778 0.415512 7-1 220 aagaagtaat ACAAACTGAA aatgttgaaa 229 2.354571 8-1 86 accacctgta ACCAAAACAA ttttagaagt 95 2.354571 9-1 713 attttttaac GTATATTGAA agttctcaat 722 0.692521 10-1 119 tgataatgtt TTCAATGTAA gagatttcga 128 0.304709 sites: * *** ** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 503 512 507 -w 0.166205 >2 764 773 768 -w 1.634349 >3 773 782 777 -w 1.385042 >4 481 490 485 -w 0.387812 >5 124 133 128 -w 0.304709 >6 769 778 773 -w 0.415512 >7 220 229 224 -w 2.354571 >8 86 95 90 -w 2.354571 >9 713 722 717 -w 0.692521 >10 119 128 123 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 48 . 38 . 0.5 3 57 . . . 0.4 4 76 . . . 0.7 5 85 . . . 1.0 9 94 . . . 1.3 10 66 . . . 0.5 non- site 30 . . . site 75 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 3 . 4 . 5 3 5 . . . 4 4 10 . . . 7 5 12 . . . 10 9 15 . . . 13 10 7 . . . 5 site 10 . . . 6 Weighted motif model: POS A C G T Prob 1 0.654853 0.018125 0.270912 0.056110 0.672399 3 0.518867 0.259878 0.192846 0.028409 0.412404 4 0.748028 0.018125 0.016568 0.217278 0.731129 5 0.901642 0.018125 0.016568 0.063665 1.140065 9 0.936898 0.018125 0.016568 0.028409 1.294744 10 0.858832 0.053381 0.016568 0.071219 0.968427 Conservedness in bits: 5.219167 Conservedness in prob: 7.814798 Concensus sequence: AAAAAA Complete log-likelihood ratio = 53 bits Missing position information = 56 bits Log-likelihood ratio statistic = -3 bits Degrees of freedom = 18 Information per parameter = -0.182 bits MOTIF I 1-1 465 tatctccatc TTTTTAAATA ccttttttaa 474 0.166205 2-1 443 caatctatat GTTGATAATT AGCGTTGCCT 452 1.634349 3-1 133 ccaggggaac TTTCCAGATT cagatcACAG 142 1.385042 4-1 616 tatcctatat TTTCTTCATT tacCGGCGCA 625 0.387812 5-1 26 ctcatctcaa TTTCTATATT ccactataaa 35 0.304709 6-1 68 gtctacagat TTTCCTGATT tgccagctta 77 0.415512 7-1 124 ctgaatgaga TTTAGTCATT atagtttttt 133 2.354571 8-1 694 taactaatac TTTCAACATT ttcagttTGT 703 2.354571 9-1 381 gccccacaca TTTCCTCATC ttataatttt 390 0.692521 10-1 233 atgactacca TTTTGTTATT gtacgtgggg 242 0.304709 sites: *** *** 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 465 474 469 -w 0.166205 >2 443 452 447 -w 1.634349 >3 133 142 137 -w 1.385042 >4 616 625 620 -w 0.387812 >5 26 35 30 -w 0.304709 >6 68 77 72 -w 0.415512 >7 124 133 128 -w 2.354571 >8 694 703 698 -w 2.354571 >9 381 390 385 -w 0.692521 >10 233 242 237 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 1.0 2 . . . 94 1.3 3 . . . 94 1.3 8 94 . . . 1.3 9 . . . 94 1.3 10 . . . 76 0.6 non- site . . . 31 site . . . 78 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 10 2 . . . 15 13 3 . . . 15 13 8 15 . . . 13 9 . . . 15 13 10 . . . 10 6 site . . . 10 8 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.165145 0.788923 0.871644 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.936898 0.018125 0.016568 0.028409 1.294744 9 0.027807 0.018125 0.016568 0.937500 1.269688 10 0.042916 0.081081 0.016568 0.859434 0.970210 Conservedness in bits: 6.945662 Conservedness in prob: 9.165396 Concensus sequence: TTTATT Complete log-likelihood ratio = 87 bits Missing position information = 71 bits Log-likelihood ratio statistic = 15 bits Degrees of freedom = 18 Information per parameter = 0.881 bits MOTIF J 1-1 618 tgccattttt CTTTCCTTT ctcagcgatg 626 0.166205 2-1 409 caagtaaaga TTTCGTGTT catgcagata 417 1.634349 3-1 315 tgcaatttct TTTTCTATT agtagctaaa 323 1.385042 4-1 695 agctcataac TTTTTTTTT tgaacctgaa 703 0.387812 5-1 254 tgttaaattt TTTTTTTTT taaatttcac 262 0.304709 6-1 457 gggggtaatt TTTCCCCTT tattttgttc 465 0.415512 7-1 266 ttatgcagct TTTCCATTT aTATATCTGT 274 2.354571 8-1 161 aattcttact TTTTTTTTG gatggacgca 169 2.354571 9-1 624 aactgcttct TTTTTTATT aaaaaacagc 632 0.692521 10-1 641 caatttgccc TTTTCCATT ttccattaaa 649 0.304709 sites: **** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 618 626 622 -w 0.166205 >2 409 417 413 -w 1.634349 >3 315 323 319 -w 1.385042 >4 695 703 699 -w 0.387812 >5 254 262 258 -w 0.304709 >6 457 465 461 -w 0.415512 >7 266 274 270 -w 2.354571 >8 161 169 165 -w 2.354571 >9 624 632 628 -w 0.692521 >10 641 649 645 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 85 1.0 2 . . . 94 1.3 3 . . . 94 1.3 4 . 29 . 66 0.7 8 . . . 94 1.3 9 . . . 85 1.0 non- site . . . 31 site . . . 91 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 12 10 2 . . . 15 13 3 . . . 15 13 4 . 2 . 7 7 8 . . . 15 13 9 . . . 12 10 site . . . 14 13 Weighted motif model: POS A C G T Prob 1 0.027807 0.033235 0.016568 0.922390 1.200918 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.418528 0.016568 0.537097 0.713894 8 0.027807 0.018125 0.016568 0.937500 1.269688 9 0.027807 0.018125 0.230620 0.723448 0.795540 Conservedness in bits: 6.519415 Conservedness in prob: 8.597282 Concensus sequence: TTTCTT Complete log-likelihood ratio = 83 bits Missing position information = 63 bits Log-likelihood ratio statistic = 20 bits Degrees of freedom = 18 Information per parameter = 1.13 bits seed 9 time: 7 seconds (0.12 minutes) MOTIF A 1-1 298 taacgttgaa ATGGAAGAAGACGTTTT ggttaaccaa 314 0.166205 2-1 227 gtatcctcgt AATCATTTTCTTGTATT tatcgtcttt 243 1.634349 3-1 677 AACAATcagt AATTGGATTGAAAATTT ggtgttgtga 693 1.385042 4-1 388 aacaaagtgc AAGCATAGTGGGGCCTT cttccaatgc 404 0.387812 5-1 722 taatgacttg ATTCAGGATGAGAGCTT aataggtgca 738 0.304709 6-1 62 aagattgtct ACAGATTTTCCTGATTT gccagcttac 78 0.415512 7-1 251 tattagttaa AGTGGTTATGCAGCTTT tccatttata 267 2.354571 8-1 478 caataaagat TCTACAATACTAGCTTT tatggttatg 494 2.354571 9-1 287 tgaagtccct AAAATTATTCCGAAATT attccctaga 303 0.692521 10-1 404 CCtactgatt AATTTTGTACTGAATTT ggacaattca 420 0.304709 sites: * ** * ** 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 298 314 306 -w 0.166205 >2 227 243 235 -w 1.634349 >3 677 693 685 -w 1.385042 >4 388 404 396 -w 0.387812 >5 722 738 730 -w 0.304709 >6 62 78 70 -w 0.415512 >7 251 267 259 -w 2.354571 >8 478 494 486 -w 2.354571 >9 287 303 295 -w 0.692521 >10 404 420 412 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 85 . . . 1.0 9 . . . 66 0.6 10 . 47 47 . 1.0 13 39 . 56 . 0.9 16 . . . 94 1.3 17 . . . 94 1.3 non- site . . . 31 site . . . 46 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 12 . . . 10 9 . . . 7 6 10 . 6 6 . 10 13 1 . 9 . 9 16 . . . 15 13 17 . . . 15 13 site . . . 3 1 Weighted motif model: POS A C G T Prob 1 0.722846 0.018125 0.016568 0.242461 0.688083 9 0.284669 0.018125 0.016568 0.680638 0.614851 10 0.027807 0.509185 0.434599 0.028409 1.039188 13 0.272078 0.018125 0.681388 0.028409 1.089439 16 0.027807 0.018125 0.016568 0.937500 1.269688 17 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 5.970937 Conservedness in prob: 8.788966 Concensus sequence: ATCGTT Complete log-likelihood ratio = 78 bits Missing position information = 64 bits Log-likelihood ratio statistic = 13 bits Degrees of freedom = 18 Information per parameter = 0.771 bits MOTIF B 1-1 346 tgttaacttc TTTGTTT ctttgttgaa 352 0.166205 2-1 19 TCATTTGGct TTTTGAT tgattgtaca 25 1.634349 3-1 7 cattaa TTTTGCT tccaagacga 13 1.385042 4-1 71 gtcttttggg TTTGTCT tcaatacggc 77 0.387812 5-1 221 tctacatttt TTTTTTT ttggaagtat 227 0.304709 6-1 468 TTCCCCttta TTTTGTT CATACATTCt 474 0.415512 7-1 181 attaacaatt TTTTGTT gatactttta 187 2.354571 8-1 636 aagcgatgat TTTTGAT ctattaacag 642 2.354571 9-1 502 aagtgccttt TTTTTTT tttttcatcc 508 0.692521 10-1 233 atgactacca TTTTGTT attgtacgtg 239 0.304709 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 346 352 349 -w 0.166205 >2 19 25 22 -w 1.634349 >3 7 13 10 -w 1.385042 >4 71 77 74 -w 0.387812 >5 221 227 224 -w 0.304709 >6 468 474 471 -w 0.415512 >7 181 187 184 -w 2.354571 >8 636 642 639 -w 2.354571 >9 502 508 505 -w 0.692521 >10 233 239 236 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 2 . . . 94 1.3 3 . . . 94 1.3 4 . . . 76 0.8 5 . . 56 39 0.9 7 . . . 94 1.3 non- site . . . 31 site . . . 86 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 2 . . . 15 13 3 . . . 15 13 4 . . . 10 8 5 . . 9 1 9 7 . . . 15 13 site . . . 13 12 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 2 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.027807 0.018125 0.066933 0.887135 1.079777 5 0.027807 0.018125 0.784637 0.169432 1.343996 7 0.027807 0.018125 0.016568 0.937500 1.269688 Conservedness in bits: 7.502524 Conservedness in prob: 9.951253 Concensus sequence: TTTTGT Complete log-likelihood ratio = 86 bits Missing position information = 60 bits Log-likelihood ratio statistic = 25 bits Degrees of freedom = 18 Information per parameter = 1.4 bits MOTIF C 1-1 269 aaggtcttgt GTTTGGCTGTTGCCGT tggtaacgtt 284 0.166205 2-1 303 tattaaccgc TTTTACTATTATCTTC tacgctgaca 318 1.634349 3-1 724 attatgcacc TTATTCAATTATCATC AAGAATAgta 739 1.385042 4-1 594 agtttaattc TAATATTAATAATATC ctatattttc 609 0.387812 5-1 192 gtgaatgagc TGATGATATTTCGCCC agttctacat 207 0.304709 6-1 164 ataacgaatt TTATGCTATTTTTTAA atttggagtt 179 0.415512 7-1 409 ggggccaggt TACTGCCAATTTTTCC tcttcataac 424 2.354571 8-1 553 tcaaattaac GAATCAAATTAACAAC cataggatga 568 2.354571 9-1 135 cgccgagact TACTTGGACTTTTCTC tattgtaaag 150 0.692521 10-1 131 caatgtaaga GATTTCGATTATCCAC aaactttaaA 146 0.304709 sites: * * * * * * 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 269 284 276 -w 0.166205 >2 303 318 310 -w 1.634349 >3 724 739 731 -w 1.385042 >4 594 609 601 -w 0.387812 >5 192 207 199 -w 0.304709 >6 164 179 171 -w 0.415512 >7 409 424 416 -w 2.354571 >8 553 568 560 -w 2.354571 >9 135 150 142 -w 0.692521 >10 131 146 138 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . 29 66 0.8 4 . . . 94 1.3 8 85 . . . 1.0 10 . . . 94 1.3 12 . . . 57 0.2 16 . 75 . . 1.0 non- site . . . 31 site . . . 58 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . 2 7 8 4 . . . 15 13 8 12 . . . 10 10 . . . 15 13 12 . . . 5 2 16 . 14 . . 10 site . . . 5 2 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.273430 0.680638 0.765506 4 0.027807 0.018125 0.016568 0.937500 1.269688 8 0.921788 0.018125 0.016568 0.043519 1.223227 10 0.027807 0.018125 0.016568 0.937500 1.269688 12 0.277114 0.045826 0.031678 0.645382 0.458609 16 0.065581 0.874333 0.016568 0.043519 1.537903 Conservedness in bits: 6.524621 Conservedness in prob: 9.063444 Concensus sequence: TTATTC Complete log-likelihood ratio = 65 bits Missing position information = 65 bits Log-likelihood ratio statistic = 0 bits Degrees of freedom = 18 Information per parameter = 0.0165 bits MOTIF D 1-1 730 tcagttcaac CATACCTGC tattatataa 738 0.166205 2-1 729 cccaggtatt CATACTTCC tattagcgga 737 1.634349 3-1 278 attcggaaag CTTCCTTCC ggaatggctt 286 1.385042 4-1 490 GAAAAtcaca CGAGCGCCC ggacgatgtc 498 0.387812 5-1 276 atttcacttt CTAAAGTCC cagaaatccg 284 0.304709 6-1 475 ttaTTTTGTT CATACATTC ttaaattgct 483 0.415512 7-1 752 attaaacttc TTTGCGTCC atccaaAAAA 760 2.354571 8-1 400 gactctcctc CGTGCGTCC tcgtcttcac 408 2.354571 9-1 580 aaatgacatt TTTCCTTTC ttctcaaact 588 0.692521 10-1 387 ctacgagaac CCTTTGTCC tactgattAA 395 0.304709 sites: * * * *** 5 (10 sites in 10 sequences) Conservedness in sites: >1 730 738 734 -w 0.166205 >2 729 737 733 -w 1.634349 >3 278 286 282 -w 1.385042 >4 490 498 494 -w 0.387812 >5 276 284 280 -w 0.304709 >6 475 483 479 -w 0.415512 >7 752 760 756 -w 2.354571 >8 400 408 404 -w 2.354571 >9 580 588 584 -w 0.692521 >10 387 395 391 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 75 . . 1.1 3 . . . 76 0.7 5 . 75 . . 1.0 7 . . . 85 1.0 8 . 65 . . 0.8 9 . 93 . . 1.8 non- site . 19 . 31 site . 56 . 36 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 14 . . 11 3 . . . 10 7 5 . 14 . . 10 7 . . . 12 10 8 . 11 . . 8 9 . 21 . . 18 site . 9 . 1 8 Weighted motif model: POS A C G T Prob 1 0.027807 0.650208 0.016568 0.305417 0.945261 3 0.090763 0.018125 0.016568 0.874544 1.019307 5 0.055508 0.871814 0.016568 0.056110 1.522688 7 0.027807 0.053381 0.016568 0.902244 1.125135 8 0.027807 0.811376 0.031678 0.129139 1.302139 9 0.027807 0.927216 0.016568 0.028409 1.804236 Conservedness in bits: 7.718766 Conservedness in prob: 11.090595 Concensus sequence: CTCTCC Complete log-likelihood ratio = 78 bits Missing position information = 71 bits Log-likelihood ratio statistic = 6 bits Degrees of freedom = 18 Information per parameter = 0.373 bits MOTIF E 1-1 94 gttgtctaag AAGTACA acgctttcat 100 0.166205 2-1 400 tcaagtcgtc AAGTAAA gatttcgtgt 406 1.634349 3-1 740 AATTATCATC AAGAATA gtaatagtta 746 1.385042 4-1 478 tcttcactat AAGAAAA tcacaCGAGC 484 0.387812 5-1 452 TATTCCGggg AAGAACA aggaagggcg 458 0.304709 6-1 313 cggtagcaac AAGAATA tagcacgagc 319 0.415512 7-1 709 agatatggat ATGTATA tggtggtaat 715 2.354571 8-1 183 ggacgcaaag AAGTTTA ataatcatat 189 2.354571 9-1 8 tagctct ATGTACA ttgccaaggt 14 0.692521 10-1 684 tacttatatg ATGATTA ggTATCATCt 690 0.304709 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 94 100 97 -w 0.166205 >2 400 406 403 -w 1.634349 >3 740 746 743 -w 1.385042 >4 478 484 481 -w 0.387812 >5 452 458 455 -w 0.304709 >6 313 319 316 -w 0.415512 >7 709 715 712 -w 2.354571 >8 183 189 186 -w 2.354571 >9 8 14 11 -w 0.692521 >10 684 690 687 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 66 . . . 0.6 3 . . 93 . 1.9 4 48 . . 48 0.5 5 76 . . . 0.7 7 94 . . . 1.3 non- site 30 . . . site 66 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 7 . . . 6 3 . . 22 . 19 4 3 . . 3 5 5 10 . . . 7 7 15 . . . 13 site 7 . . . 6 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.632189 0.018125 0.016568 0.333118 0.572850 3 0.027807 0.018125 0.925659 0.028409 1.913088 4 0.282151 0.018125 0.016568 0.683156 0.617963 5 0.695145 0.018125 0.016568 0.270162 0.646549 7 0.936898 0.018125 0.016568 0.028409 1.294744 Conservedness in bits: 6.339938 Conservedness in prob: 8.934604 Concensus sequence: AAGTAA Complete log-likelihood ratio = 82 bits Missing position information = 64 bits Log-likelihood ratio statistic = 17 bits Degrees of freedom = 18 Information per parameter = 0.974 bits MOTIF F 1-1 505 tctaagtagt AAAAGTA ttatgcatag 511 0.166205 2-1 759 tcaggagtgc AAAAAGA gaaaataaaa 765 1.634349 3-1 666 agacatatat AAACAAT cagtAATTGG 672 1.385042 4-1 124 ctgccatggc AAAGAAT gctttccatg 130 0.387812 5-1 665 tacggcagta AAGAATT gctttactgg 671 0.304709 6-1 579 tccttaaccc AAAAATA agggaaaggg 585 0.415512 7-1 767 GTCCatccaa AAAAAAA gtaagaattt 773 2.354571 8-1 90 cctgtaacca AAACAAT tttagaagta 96 2.354571 9-1 421 tcatcgtgag AGAAAAT acgagtccaT 427 0.692521 10-1 765 ttcggttcga AGACATT cctacgcata 771 0.304709 sites: ***** * 5 (10 sites in 10 sequences) Conservedness in sites: >1 505 511 508 -w 0.166205 >2 759 765 762 -w 1.634349 >3 666 672 669 -w 1.385042 >4 124 130 127 -w 0.387812 >5 665 671 668 -w 0.304709 >6 579 585 582 -w 0.415512 >7 767 773 770 -w 2.354571 >8 90 96 93 -w 2.354571 >9 421 427 424 -w 0.692521 >10 765 771 768 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 94 . . . 1.3 2 76 . . . 0.8 3 85 . . . 1.0 4 57 29 . . 0.5 5 85 . . . 1.0 7 39 . . 57 0.5 non- site 30 . . . site 76 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 15 . . . 13 2 10 . . . 8 3 12 . . . 10 4 5 2 . . 5 5 12 . . . 10 7 1 . . 5 5 site 10 . . . 7 Weighted motif model: POS A C G T Prob 1 0.936898 0.018125 0.016568 0.028409 1.294744 2 0.846240 0.018125 0.107225 0.028409 0.999349 3 0.909197 0.018125 0.044269 0.028409 1.177581 4 0.533977 0.385791 0.051824 0.028409 0.604330 5 0.921788 0.018125 0.031678 0.028409 1.226071 7 0.443319 0.018125 0.016568 0.521988 0.503690 Conservedness in bits: 5.805766 Conservedness in prob: 7.938711 Concensus sequence: AAACAT Complete log-likelihood ratio = 65 bits Missing position information = 56 bits Log-likelihood ratio statistic = 9 bits Degrees of freedom = 18 Information per parameter = 0.509 bits MOTIF G 1-1 704 acagatcgat ATGCTTTGG tgttcaatca 712 0.166205 2-1 8 atgctaa ATCATTTGG ctTTTTGATt 16 1.634349 3-1 515 ttcccatctc AAGATGGGG agcaaatggc 523 1.385042 4-1 14 cctttacgtt TTGACTTGG tgctcgaaga 22 0.387812 5-1 138 agagatgaag TTATTTGGG ctctttgctc 146 0.304709 6-1 429 attggtagta TTCGTTTGG taaagtagag 437 0.415512 7-1 643 aagagaaggt TTTTTTAGG ctaagataat 651 2.354571 8-1 162 attcttactt TTTTTTTGG atggacgcaa 170 2.354571 9-1 396 tcatcttata ATTTTGTGG aaaaattcat 404 0.692521 10-1 156 Caaactttaa AACACAGGG acaaaattct 164 0.304709 sites: ** ** ** 5 (10 sites in 10 sequences) Conservedness in sites: >1 704 712 708 -w 0.166205 >2 8 16 12 -w 1.634349 >3 515 523 519 -w 1.385042 >4 14 22 18 -w 0.387812 >5 138 146 142 -w 0.304709 >6 429 437 433 -w 0.415512 >7 643 651 647 -w 2.354571 >8 162 170 166 -w 2.354571 >9 396 404 400 -w 0.692521 >10 156 164 160 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 48 . . 48 0.5 2 . . . 76 0.7 5 . . . 76 0.8 6 . . . 66 0.5 8 . . 93 . 1.9 9 . . 93 . 1.9 non- site . . 18 31 site . . 36 46 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 3 . . 3 5 2 . . . 10 7 5 . . . 10 8 6 . . . 7 5 8 . . 22 . 19 9 . . 22 . 19 site . . 4 3 4 Weighted motif model: POS A C G T Prob 1 0.408064 0.018125 0.016568 0.557243 0.514667 2 0.181421 0.018125 0.016568 0.783886 0.783313 5 0.027807 0.081081 0.016568 0.874544 1.039653 6 0.055508 0.018125 0.205437 0.720930 0.705567 8 0.027807 0.018125 0.925659 0.028409 1.913088 9 0.027807 0.018125 0.925659 0.028409 1.913088 Conservedness in bits: 6.869376 Conservedness in prob: 9.541040 Concensus sequence: TTTTGG Complete log-likelihood ratio = 81 bits Missing position information = 63 bits Log-likelihood ratio statistic = 17 bits Degrees of freedom = 18 Information per parameter = 0.955 bits MOTIF H 1-1 455 gattaataca TATCTCC atctttttaa 461 0.166205 2-1 210 tgtacatacc TCTCTCC gtatcctcgt 216 1.634349 3-1 32 gacagtaata TGTCTCC tacaatacca 38 1.385042 4-1 564 acccctttct TCTCTCC cctgcaatat 570 0.387812 5-1 473 agggcggtct TTTCTCC ctcattgtca 479 0.304709 6-1 457 gggggtaatt TTTCCCC tttaTTTTGT 463 0.415512 7-1 558 Gtcggagggc TGTCGCC cgctcggcgg 564 2.354571 8-1 66 tgtgaaccaa TGTATCC agcaccacct 72 2.354571 9-1 437 Tacgagtcca TTTCTCC agtgaaacta 443 0.692521 10-1 693 gATGATTAgg TATCATC tgtataaaac 699 0.304709 sites: * ***** 5 (10 sites in 10 sequences) Conservedness in sites: >1 455 461 458 -w 0.166205 >2 210 216 213 -w 1.634349 >3 32 38 35 -w 1.385042 >4 564 570 567 -w 0.387812 >5 473 479 476 -w 0.304709 >6 457 463 460 -w 0.415512 >7 558 564 561 -w 2.354571 >8 66 72 69 -w 2.354571 >9 437 443 440 -w 0.692521 >10 693 699 696 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . . . 94 1.3 3 . . . 94 1.3 4 . 84 . . 1.4 5 . . . 66 0.4 6 . 84 . . 1.4 7 . 93 . . 1.8 non- site . 19 . 31 site . 48 . 46 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . . . 15 13 3 . . . 15 13 4 . 17 . . 14 5 . . . 7 4 6 . 17 . . 14 7 . 21 . . 18 site . 6 . 3 7 Weighted motif model: POS A C G T Prob 1 0.027807 0.018125 0.016568 0.937500 1.269688 3 0.027807 0.018125 0.016568 0.937500 1.269688 4 0.241859 0.713164 0.016568 0.028409 1.073798 5 0.055508 0.055899 0.230620 0.657973 0.545874 6 0.027807 0.899515 0.016568 0.056110 1.662716 7 0.027807 0.927216 0.016568 0.028409 1.804236 Conservedness in bits: 7.626000 Conservedness in prob: 10.473931 Concensus sequence: TTCTCC Complete log-likelihood ratio = 94 bits Missing position information = 71 bits Log-likelihood ratio statistic = 22 bits Degrees of freedom = 18 Information per parameter = 1.26 bits MOTIF I 1-1 672 gccttacttt AAAAGCATGT tgagtgaatt 681 0.166205 2-1 644 acataggcag TAAAATTTTT actgaaacgt 653 1.634349 3-1 783 acataataaa AAAAATAATT ctttcata 792 1.385042 4-1 682 cataataacc AAAAGCTCAT aacttttttt 691 0.387812 5-1 379 ctcttgtcaa CAAACTTCCT atggagtgta 388 0.304709 6-1 775 catgataaaa AAAAACAGTT gaatattccc 784 0.415512 7-1 338 aataaggcta AAAAACTAAT cgcattatca 347 2.354571 8-1 286 tcttagccta AAAAAACCTT ctctttggaa 295 2.354571 9-1 551 ctccattaag AAAAAAAATT tatataacca 560 0.692521 10-1 535 TAGACCGGaa AAAAGTCGTA tgacatcaga 544 0.304709 sites: ***** * 5 10 (10 sites in 10 sequences) Conservedness in sites: >1 672 681 676 -w 0.166205 >2 644 653 648 -w 1.634349 >3 783 792 787 -w 1.385042 >4 682 691 686 -w 0.387812 >5 379 388 383 -w 0.304709 >6 775 784 779 -w 0.415512 >7 338 347 342 -w 2.354571 >8 286 295 290 -w 2.354571 >9 551 560 555 -w 0.692521 >10 535 544 539 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 76 . . . 0.7 2 94 . . . 1.3 3 94 . . . 1.3 4 94 . . . 1.3 5 57 . 29 . 0.5 10 . . . 85 0.9 non- site 30 . . . site 75 . . . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 10 . . . 7 2 15 . . . 13 3 15 . . . 13 4 15 . . . 13 5 5 . 2 . 5 10 . . . 12 9 site 10 . . . 6 Weighted motif model: POS A C G T Prob 1 0.760620 0.045826 0.016568 0.176986 0.699940 2 0.936898 0.018125 0.016568 0.028409 1.294744 3 0.936898 0.018125 0.016568 0.028409 1.294744 4 0.936898 0.018125 0.016568 0.028409 1.294744 5 0.831131 0.045826 0.094634 0.028409 0.913639 10 0.055508 0.018125 0.016568 0.909799 1.145941 Conservedness in bits: 6.643753 Conservedness in prob: 9.142907 Concensus sequence: AAAAAT Complete log-likelihood ratio = 73 bits Missing position information = 60 bits Log-likelihood ratio statistic = 13 bits Degrees of freedom = 18 Information per parameter = 0.749 bits MOTIF J 1-1 545 tttttgggcc CGGAATATATCTTTTCG ggaagctcgg 561 0.166205 2-1 513 accccacgtt CGGTCCACTGTGTGCCG aacatgctcc 529 1.634349 3-1 404 ttcgtccgtg CGGAGATATCTGCGCCG ttcaggggtc 420 1.385042 4-1 629 cttcatttac CGGCGCACTCTCGCCCG aacgacctca 645 0.387812 5-1 432 ggcgaacaat CGGGGCAGACTATTCCG gggAAGAACA 448 0.304709 6-1 609 aaaaagcgct CGGACAACTGTTGACCG tgatccgaag 625 0.415512 7-1 532 cgaggacgca CGGAGGAGAGTCTTCCG tcggagggcT 548 2.354571 8-1 348 tattgaagta CGGATTAGAAGCCGCCG agcgggcgac 364 2.354571 9-1 332 gaaaaaggtc CGGGGAAATGGAGTCCG tgcgagtttt 348 0.692521 10-1 516 aaagctttca CCGATTTCCTAGACCGG aaAAAAGTCG 532 0.304709 sites: *** *** 5 10 15 (10 sites in 10 sequences) Conservedness in sites: >1 545 561 553 -w 0.166205 >2 513 529 521 -w 1.634349 >3 404 420 412 -w 1.385042 >4 629 645 637 -w 0.387812 >5 432 448 440 -w 0.304709 >6 609 625 617 -w 0.415512 >7 532 548 540 -w 2.354571 >8 348 364 356 -w 2.354571 >9 332 348 340 -w 0.692521 >10 516 532 524 -w 0.304709 Conservedness end. Motif model (residue frequency x 100): POS A C G T Info 1 . 93 . . 1.8 2 . . 83 . 1.5 3 . . 93 . 1.9 15 . 84 . . 1.4 16 . 84 . . 1.5 17 . . 93 . 1.9 non- site . 19 18 . site . 48 50 . 6 columns Information (relative entropy) contribution in tenth bits: POS A C G T Info 1 . 21 . . 18 2 . . 18 . 15 3 . . 22 . 19 15 . 17 . . 14 16 . 17 . . 15 17 . . 22 . 19 site . 6 7 . 13 Weighted motif model: POS A C G T Prob 1 0.027807 0.927216 0.016568 0.028409 1.804236 2 0.027807 0.045826 0.897958 0.028409 1.774276 3 0.027807 0.018125 0.925659 0.028409 1.913088 15 0.027807 0.912106 0.016568 0.043519 1.723618 16 0.027807 0.899515 0.044269 0.028409 1.670390 17 0.027807 0.018125 0.925659 0.028409 1.913088 Conservedness in bits: 10.798696 Conservedness in prob: 13.574655 Concensus sequence: CGGCCG Complete log-likelihood ratio = 126 bits Missing position information = 86 bits Log-likelihood ratio statistic = 39 bits Degrees of freedom = 18 Information per parameter = 2.21 bits seed 10 time: 7 seconds (0.12 minutes)